ID: 967847022

View in Genome Browser
Species Human (GRCh38)
Location 3:194052257-194052279
Sequence CAGACTCCACAAAAGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967847017_967847022 1 Left 967847017 3:194052233-194052255 CCACATTCAGCCTCTGCTCCCAG No data
Right 967847022 3:194052257-194052279 CAGACTCCACAAAAGGAGCAAGG No data
967847018_967847022 -9 Left 967847018 3:194052243-194052265 CCTCTGCTCCCAGACAGACTCCA No data
Right 967847022 3:194052257-194052279 CAGACTCCACAAAAGGAGCAAGG No data
967847015_967847022 27 Left 967847015 3:194052207-194052229 CCTCAAGGAAGCTCAGGAGGCTG No data
Right 967847022 3:194052257-194052279 CAGACTCCACAAAAGGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967847022 Original CRISPR CAGACTCCACAAAAGGAGCA AGG Intergenic
No off target data available for this crispr