ID: 967847895

View in Genome Browser
Species Human (GRCh38)
Location 3:194058461-194058483
Sequence CCGCCGCGAGGCTGAGCCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967847882_967847895 21 Left 967847882 3:194058417-194058439 CCTAGCCAAAGATGGAACCGTTT No data
Right 967847895 3:194058461-194058483 CCGCCGCGAGGCTGAGCCGGTGG No data
967847883_967847895 16 Left 967847883 3:194058422-194058444 CCAAAGATGGAACCGTTTTGTTG No data
Right 967847895 3:194058461-194058483 CCGCCGCGAGGCTGAGCCGGTGG No data
967847888_967847895 4 Left 967847888 3:194058434-194058456 CCGTTTTGTTGGGAGCTCGGGTT No data
Right 967847895 3:194058461-194058483 CCGCCGCGAGGCTGAGCCGGTGG No data
967847881_967847895 28 Left 967847881 3:194058410-194058432 CCAAAGGCCTAGCCAAAGATGGA No data
Right 967847895 3:194058461-194058483 CCGCCGCGAGGCTGAGCCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967847895 Original CRISPR CCGCCGCGAGGCTGAGCCGG TGG Intergenic
No off target data available for this crispr