ID: 967849805

View in Genome Browser
Species Human (GRCh38)
Location 3:194073172-194073194
Sequence TTACCTTGAATGTGGCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967849805_967849807 18 Left 967849805 3:194073172-194073194 CCAGCTGGCCACATTCAAGGTAA No data
Right 967849807 3:194073213-194073235 ACTGTGAACCTACTATTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967849805 Original CRISPR TTACCTTGAATGTGGCCAGC TGG (reversed) Intergenic
No off target data available for this crispr