ID: 967853217

View in Genome Browser
Species Human (GRCh38)
Location 3:194097631-194097653
Sequence GGGGTAGTCCCCCGGGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967853217_967853227 11 Left 967853217 3:194097631-194097653 CCTTGGCCCCGGGGGACTACCCC No data
Right 967853227 3:194097665-194097687 GGACCTGCAGAATCAATAACTGG No data
967853217_967853222 -10 Left 967853217 3:194097631-194097653 CCTTGGCCCCGGGGGACTACCCC No data
Right 967853222 3:194097644-194097666 GGACTACCCCCTCTGAGCGTGGG No data
967853217_967853231 22 Left 967853217 3:194097631-194097653 CCTTGGCCCCGGGGGACTACCCC No data
Right 967853231 3:194097676-194097698 ATCAATAACTGGAAGGGACAAGG No data
967853217_967853229 15 Left 967853217 3:194097631-194097653 CCTTGGCCCCGGGGGACTACCCC No data
Right 967853229 3:194097669-194097691 CTGCAGAATCAATAACTGGAAGG No data
967853217_967853232 23 Left 967853217 3:194097631-194097653 CCTTGGCCCCGGGGGACTACCCC No data
Right 967853232 3:194097677-194097699 TCAATAACTGGAAGGGACAAGGG No data
967853217_967853230 16 Left 967853217 3:194097631-194097653 CCTTGGCCCCGGGGGACTACCCC No data
Right 967853230 3:194097670-194097692 TGCAGAATCAATAACTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967853217 Original CRISPR GGGGTAGTCCCCCGGGGCCA AGG (reversed) Intergenic