ID: 967853878

View in Genome Browser
Species Human (GRCh38)
Location 3:194101923-194101945
Sequence GTGCTCTCCCTTGCTTCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967853878_967853881 9 Left 967853878 3:194101923-194101945 CCTGGAGAAGCAAGGGAGAGCAC No data
Right 967853881 3:194101955-194101977 ATCCAACTAAAGGTTCCCTAAGG No data
967853878_967853883 15 Left 967853878 3:194101923-194101945 CCTGGAGAAGCAAGGGAGAGCAC No data
Right 967853883 3:194101961-194101983 CTAAAGGTTCCCTAAGGTGCAGG No data
967853878_967853884 16 Left 967853878 3:194101923-194101945 CCTGGAGAAGCAAGGGAGAGCAC No data
Right 967853884 3:194101962-194101984 TAAAGGTTCCCTAAGGTGCAGGG No data
967853878_967853879 -1 Left 967853878 3:194101923-194101945 CCTGGAGAAGCAAGGGAGAGCAC No data
Right 967853879 3:194101945-194101967 CAGTCCTCACATCCAACTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967853878 Original CRISPR GTGCTCTCCCTTGCTTCTCC AGG (reversed) Intergenic
No off target data available for this crispr