ID: 967858335

View in Genome Browser
Species Human (GRCh38)
Location 3:194134524-194134546
Sequence CGTGACCGCGGCGGGCGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967858326_967858335 8 Left 967858326 3:194134493-194134515 CCGGCCGCTTCCTAAGTGCGGTC 0: 1
1: 0
2: 0
3: 3
4: 45
Right 967858335 3:194134524-194134546 CGTGACCGCGGCGGGCGCCCAGG 0: 1
1: 0
2: 0
3: 22
4: 151
967858325_967858335 9 Left 967858325 3:194134492-194134514 CCCGGCCGCTTCCTAAGTGCGGT 0: 1
1: 0
2: 0
3: 6
4: 34
Right 967858335 3:194134524-194134546 CGTGACCGCGGCGGGCGCCCAGG 0: 1
1: 0
2: 0
3: 22
4: 151
967858329_967858335 -2 Left 967858329 3:194134503-194134525 CCTAAGTGCGGTCAGGCATCCCG 0: 1
1: 0
2: 0
3: 2
4: 42
Right 967858335 3:194134524-194134546 CGTGACCGCGGCGGGCGCCCAGG 0: 1
1: 0
2: 0
3: 22
4: 151
967858328_967858335 4 Left 967858328 3:194134497-194134519 CCGCTTCCTAAGTGCGGTCAGGC 0: 1
1: 0
2: 0
3: 7
4: 63
Right 967858335 3:194134524-194134546 CGTGACCGCGGCGGGCGCCCAGG 0: 1
1: 0
2: 0
3: 22
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967858335 Original CRISPR CGTGACCGCGGCGGGCGCCC AGG Intergenic
900199771 1:1399237-1399259 CGCGGCAGCGGCCGGCGCCCCGG - Exonic
900206980 1:1435821-1435843 GGTGAGTGCGGCGGGCGGCCGGG + Exonic
900283917 1:1890505-1890527 CGTGGCGGCGGCCGGGGCCCCGG - Intronic
900458700 1:2789957-2789979 AGGGGACGCGGCGGGCGCCCGGG - Intronic
901577166 1:10210457-10210479 CGTGTCCGTCGCGGGCGCCGGGG + Intergenic
901602149 1:10430673-10430695 CGCAGCCGCGGGGGGCGCCCGGG - Intronic
903077886 1:20786583-20786605 CGTCGCCGGGGCGGGCGCCGCGG - Intronic
904050208 1:27634291-27634313 CGAGACCGCCGCGGGCGCGGAGG + Intronic
904297080 1:29526811-29526833 CGTGACAGCGGCAGGAGCCCTGG - Intergenic
904769074 1:32870938-32870960 CGCGTCCACGTCGGGCGCCCGGG + Intronic
905308408 1:37034137-37034159 CGCGGCCGTGGCGGGCTCCCTGG + Intergenic
905819722 1:40979997-40980019 CGGGAGTGGGGCGGGCGCCCCGG + Intronic
906525225 1:46489775-46489797 CGGGCCCGCGCCGGGCGCCCGGG + Intergenic
907136206 1:52142000-52142022 CGGGACTGCGGCGGCCGCGCTGG - Intergenic
907223893 1:52927361-52927383 CGGGACCGGGGCGGGCGCCGCGG - Exonic
907429880 1:54405782-54405804 CGAGGCCGCGGCGGGCGGCGTGG - Intronic
911647605 1:100352773-100352795 GGTCAGCGCGCCGGGCGCCCCGG - Exonic
915127924 1:153678900-153678922 CGCGACCGAGGGGGGCGCGCAGG - Exonic
916890296 1:169106768-169106790 GGTGGCTGCGGCGCGCGCCCTGG - Exonic
918282848 1:183023195-183023217 CGGGCCCGCGGCGCGCGACCCGG - Intergenic
921155159 1:212433228-212433250 GCGGCCCGCGGCGGGCGCCCTGG + Intronic
924732472 1:246724488-246724510 CGTGACCGAGGAGGTGGCCCGGG + Exonic
1062973030 10:1662767-1662789 TGTGACCACGCCGGGTGCCCAGG + Intronic
1065100454 10:22325824-22325846 CCTGAGCGCGGCGGACGCCCGGG - Intronic
1065687683 10:28302688-28302710 GGTGCCCGCCGCGGGCTCCCAGG + Intronic
1071309463 10:84328841-84328863 CGGGGTCGCGGCGGGCGCCGGGG + Intronic
1072151786 10:92690004-92690026 CGGGCCGGCGGCGGGCGCCGTGG + Exonic
1074065278 10:110007894-110007916 CGTGACCGGGGGGGGCGCTTGGG + Intronic
1075885634 10:125896679-125896701 TGGGACCGGGGCGGGCGACCGGG + Intronic
1077048245 11:555520-555542 CGTGAGGGCGGCGGCCGGCCCGG + Intronic
1077250234 11:1557596-1557618 CCTGGCCCCGGCGGGCGCCTGGG - Intronic
1077359175 11:2133109-2133131 CGTGACCCCGGCGGGCACGCAGG + Exonic
1079296628 11:19240987-19241009 CGGGACTGCGGCGGGCGGACAGG - Intronic
1080037308 11:27722666-27722688 GGTGAGCGCGGCGGGAGCCAGGG + Intergenic
1083659770 11:64246670-64246692 CGTGGCCCCGGCGGCCGCCATGG - Exonic
1088401021 11:109422800-109422822 CGCGACCGCGGCTGACGCGCAGG - Intronic
1089495902 11:118908605-118908627 GGGGACAGCGGCGGGCTCCCTGG + Exonic
1091616101 12:2052625-2052647 GGCCACCGCGGCTGGCGCCCGGG + Intronic
1096250067 12:50025299-50025321 CGTGGCCGCCGCGGGGGTCCGGG - Intronic
1097891469 12:64781189-64781211 CGGCACCGCTGCGGCCGCCCAGG - Intronic
1102962040 12:117099283-117099305 GGTGCCCGCGGCGGGGGCCCCGG + Exonic
1102997448 12:117361207-117361229 CGCGGCGGCCGCGGGCGCCCGGG - Intronic
1104030963 12:125065565-125065587 CATGGCGGCGGCGGGCGGCCGGG - Exonic
1104706858 12:130954133-130954155 TGTGACCGCGACCTGCGCCCGGG - Exonic
1108555278 13:51585018-51585040 CGGGACGGCGGCGAGCGCTCCGG + Intronic
1112506994 13:99981408-99981430 CCTGACCGCGGCGGGGGCGCCGG - Intergenic
1114461193 14:22887045-22887067 TGTGACCGCCGGGGGCGGCCCGG + Exonic
1121645741 14:95516400-95516422 CGTGACAGCTGCGGGCGGGCGGG - Intronic
1122399542 14:101458704-101458726 CGAGGCCGCGGGGGGCGCCGCGG - Intergenic
1122830642 14:104393955-104393977 CGTCACAGCCGCGGGTGCCCAGG - Intergenic
1202872436 14_GL000225v1_random:177261-177283 TGTGACCGGGGCGGGCGACCGGG - Intergenic
1123464571 15:20506002-20506024 CGTGGGCGCGGCGGCCGCACCGG - Intergenic
1123487637 15:20755779-20755801 CCTGGCGGCGGCGGCCGCCCGGG + Intergenic
1123544129 15:21324837-21324859 CCTGGCGGCGGCGGCCGCCCGGG + Intergenic
1123653543 15:22495039-22495061 CGTGGGCGCGGCGGCCGCACCGG + Intergenic
1124275300 15:28321969-28321991 CGTGGGCGCGGCGGCCGCACCGG - Intronic
1124307404 15:28589632-28589654 CGTGGGCGCGGCGGCCGCACCGG + Intergenic
1128099905 15:64989967-64989989 CGTGGCCCCGGCGGTCGCCACGG + Intronic
1128374492 15:67065629-67065651 CGGGAGCGCGGCGCACGCCCCGG + Intronic
1202952471 15_KI270727v1_random:52110-52132 CCTGGCGGCGGCGGCCGCCCGGG + Intergenic
1135517621 16:23148962-23148984 CGTGGGCGCGGCGGCCGGCCCGG + Exonic
1136570657 16:31094624-31094646 CGTGAAGGCGGCGCGCGCCCGGG - Exonic
1139598123 16:67969635-67969657 CGGGCCCGCTGCGGGGGCCCTGG - Intergenic
1140847266 16:78902536-78902558 CGTGACTGCTGCGGGGGCCTAGG + Intronic
1142631689 17:1229784-1229806 CGCGGCGGGGGCGGGCGCCCCGG + Intergenic
1144586823 17:16492194-16492216 CGGGCCGGCGGCGAGCGCCCGGG - Intergenic
1145094184 17:20009919-20009941 CGGGAGCGCGGCGGACGCCGAGG - Intronic
1147962509 17:44176813-44176835 CGTGGCGGCGGCGCGCGGCCTGG + Exonic
1148714817 17:49708323-49708345 CTTTTCCGCGGCGGGCGGCCAGG + Intronic
1151508638 17:74544903-74544925 CATGACCGTGGCGGGCCCCGTGG - Exonic
1151660350 17:75515405-75515427 CCGGACCCCGGCGGGCGGCCGGG - Exonic
1155199349 18:23503587-23503609 CGCGCCCGCGGCGGGGGCCCCGG - Exonic
1155392330 18:25350320-25350342 GGTGCCCGCGGCCGGCGGCCGGG + Intronic
1156275819 18:35581802-35581824 CGCGACCGCCGCGGCCGGCCCGG + Intronic
1157815912 18:50729490-50729512 CGTGGCCGTGGGGGGCGCGCCGG - Exonic
1158893612 18:61894372-61894394 CGCGAACGCGGAGGGCGGCCGGG - Intergenic
1159040593 18:63320082-63320104 CGGGAGCGCGGCGGGCGGGCGGG + Exonic
1160543420 18:79637963-79637985 CGTGTCCGCGCGTGGCGCCCCGG - Intergenic
1160577273 18:79863802-79863824 CGTGGCCGCGGCAGGCGCGCAGG - Exonic
1160719589 19:591312-591334 CGTGACCGCGGCGGGGTTCCCGG + Intronic
1160725016 19:614033-614055 CGTGGCCGGGGCGGGTGCCCTGG + Intronic
1160877715 19:1304947-1304969 CCTGCCCGCGGCGGGCACCGAGG - Intergenic
1161254067 19:3296631-3296653 CGTGTCCGCGGCGCCCGCCGAGG + Intronic
1162019930 19:7863735-7863757 CGCAGCCGCGGGGGGCGCCCGGG + Intronic
1162741283 19:12775244-12775266 CGTGACGGGGGCGGGTGCTCGGG + Intronic
1163635104 19:18433914-18433936 CGTGACCGCGGCGGGCCAGGTGG + Intronic
1166245381 19:41522084-41522106 CGTGCCGGCGGAGGGGGCCCGGG - Intergenic
1166290491 19:41860370-41860392 CGGGCCCGCGCCGGGCGCCTCGG - Intronic
1167073010 19:47231304-47231326 CTTGTCCGCGGCGGGCGGGCGGG - Intronic
1167145987 19:47681044-47681066 GCTGACCGCGGGGGGCGCCTGGG - Exonic
1167575282 19:50314877-50314899 GGGGAGCGCGGCGGGCGGCCCGG + Intronic
1167578477 19:50328914-50328936 CGCGTCCCCGGCGGGCCCCCCGG - Exonic
1167613362 19:50517798-50517820 CGTGGCCGCCGCGGCCGCCGTGG - Exonic
1167633496 19:50639836-50639858 CGGCACCGCGGCTGGCGCGCGGG - Intronic
1168078491 19:53992930-53992952 CGGGCCGGCGGCGGGCGCACGGG + Exonic
1168347107 19:55655278-55655300 CGTGAACGAGGCGCGCGCCACGG - Intronic
926303205 2:11618570-11618592 CGTGCCGGCAGCGGGCGCCACGG - Exonic
927990338 2:27442763-27442785 GGTGAGCGCGGCAGGCGACCCGG + Exonic
928042328 2:27890743-27890765 CCTGCCCGCGGCGCGCGCGCAGG + Exonic
928099837 2:28430484-28430506 CGTGACCCCGGAGGAAGCCCAGG - Intergenic
928904352 2:36355383-36355405 CGTGGCCGCAGCGGCCGGCCTGG - Intergenic
931256905 2:60581882-60581904 GGTGGAGGCGGCGGGCGCCCCGG - Intergenic
936433268 2:112482241-112482263 CCGGGCCGCGGCGGGCGCCCGGG + Exonic
942681387 2:178480755-178480777 CGTGCCGGCGGAGGGGGCCCGGG + Exonic
947353658 2:229271382-229271404 CATGCCCGGGGCGGGCGCCCAGG + Intergenic
948487208 2:238288588-238288610 CGTAACCGCCGCCGGCGCGCGGG - Exonic
948645158 2:239400216-239400238 CGTCGCCGCTGCGAGCGCCCGGG - Intronic
948991675 2:241558860-241558882 CGTGGACGGGGCGGGCGCCGGGG + Exonic
1170964312 20:21052658-21052680 GGTGACTGCAGTGGGCGCCCAGG + Intergenic
1172702907 20:36863625-36863647 CGTGCGGGCGGCGGGGGCCCGGG - Exonic
1174386600 20:50191293-50191315 CGTGGCCGTGGCGGGCGCCGGGG - Exonic
1176084914 20:63291461-63291483 CGTCGCCGTGGCGGGCTCCCAGG - Intergenic
1181312527 22:21952876-21952898 CCTGGCCGCCGCGGGCGCCGCGG + Intergenic
1182103659 22:27674112-27674134 AGTGACAGCAGCGGGAGCCCCGG + Intergenic
1182664095 22:31944820-31944842 GGTGAGCGCGCCGGGAGCCCGGG + Exonic
1183702218 22:39457245-39457267 AGGGACCGCGGCGGGCGCGCGGG - Intergenic
1184271739 22:43388392-43388414 CGCGCCCCCGGCGGGAGCCCGGG + Intergenic
1184342103 22:43891742-43891764 CGTAGATGCGGCGGGCGCCCTGG + Exonic
1184853062 22:47131850-47131872 CTTGGACGGGGCGGGCGCCCCGG - Intronic
950457347 3:13100543-13100565 TGGGACAGCGGCGGGCGCCCAGG + Intergenic
952788044 3:37175900-37175922 CCGGCCCGCGGCGGGCTCCCGGG - Intronic
952942606 3:38455258-38455280 CCTAACCCCGGCGGGCGCGCCGG + Intronic
958641503 3:96813415-96813437 CGCGGCGGAGGCGGGCGCCCAGG - Intergenic
961324356 3:126101514-126101536 CGTGACTGCAGTGGGCGCCCTGG + Intronic
961785393 3:129344136-129344158 CCTGACCCCTGCGGGCGGCCGGG - Intergenic
966696237 3:182793411-182793433 CGGGACCGCCCCCGGCGCCCCGG - Intergenic
967858335 3:194134524-194134546 CGTGACCGCGGCGGGCGCCCAGG + Intergenic
967880358 3:194297256-194297278 CGTGGGCGCAGCGGGGGCCCGGG - Intergenic
968010439 3:195270858-195270880 CGAGGGCGCGGCGGGAGCCCCGG + Exonic
968133631 3:196207469-196207491 CGTGTCCGCCGCGGGCCTCCTGG - Exonic
968746890 4:2364973-2364995 AGTGACCCCCGCGTGCGCCCGGG - Intronic
969525044 4:7700050-7700072 CGTGGCTGGGGCGGGAGCCCTGG - Intronic
973292490 4:48483824-48483846 CGGGAGCGCGTGGGGCGCCCAGG - Exonic
980923914 4:139115371-139115393 CGTGGCCCCGGCGGCCGCCATGG - Intronic
983254146 4:165379310-165379332 CATGCCCGCCGCGGGCGCCCCGG - Exonic
984811150 4:183797525-183797547 AGGGACTGCGCCGGGCGCCCGGG + Intergenic
989103512 5:37840363-37840385 CTTGACCGCGGCGCCCGCGCCGG + Intergenic
990376196 5:55173295-55173317 CGGGGCCGCGGCGCGCGCCGGGG - Intergenic
991435745 5:66596199-66596221 CGGGACCACGGCCCGCGCCCGGG + Intergenic
992431458 5:76715357-76715379 GGTGACCCCGGCGGGCGGCGCGG + Intergenic
1000230438 5:159310685-159310707 CACGACCGCGGCGGGCGGGCGGG + Intergenic
1002368161 5:178729406-178729428 CGTGAACGGGGCAGGTGCCCCGG - Intronic
1002385164 5:178860642-178860664 CGTGAACGGGGCAGGTGCCCCGG + Intronic
1005965137 6:30721570-30721592 CGTGACTGCGGCGCACGCGCAGG - Intronic
1006770301 6:36547422-36547444 CGTCTCCGCGGCGGGGGACCGGG - Exonic
1014272265 6:119348775-119348797 CGCGTCCTCGGCGCGCGCCCCGG + Exonic
1016590162 6:145735348-145735370 CGGCACCGCGGCGGGCGACGGGG - Exonic
1018091225 6:160348228-160348250 CGGGGCTGCTGCGGGCGCCCGGG + Intergenic
1018956395 6:168413169-168413191 CGTGAGCGCGGCGGGCCCTGCGG + Intergenic
1018956430 6:168413297-168413319 CGTGAGCGCGGCGGGCCCTGCGG + Intergenic
1019395813 7:816983-817005 GGAGGCCGCGGCGGGCGGCCCGG + Intronic
1019989658 7:4682578-4682600 GGTGGCCGCGGCGGCCGCCTCGG + Exonic
1022375554 7:29807572-29807594 TGTGCCCGTGGCGGGCGCCGGGG + Intronic
1029728481 7:102424320-102424342 CGTGCCTGCGGCCGGCGTCCTGG + Intronic
1029821223 7:103149373-103149395 GGCGACCGCGGCAGGCGCTCGGG + Intronic
1030033324 7:105388492-105388514 CCTGCCCCCGGCGGGCGGCCCGG - Intronic
1031213309 7:118858771-118858793 CGCCACTGCGGCGGGCTCCCGGG - Intergenic
1035222491 7:157414356-157414378 CGTGACTGTGGAGGGCGGCCAGG - Intronic
1035265170 7:157686046-157686068 CGTGACCGCGGGCAGCGCCGGGG + Intronic
1035637073 8:1155414-1155436 TGGGATCGCGGCGGGCGCACCGG + Intergenic
1035731173 8:1854322-1854344 TGTGCCCACGGCGGGCGCCCAGG - Intronic
1037529187 8:19757250-19757272 CGAGTCCGCGGCGGCCGCGCAGG - Intronic
1038327019 8:26579101-26579123 GGGGACCGCGGCGAGCGGCCGGG + Intronic
1042696025 8:71556390-71556412 CGTGGCTGCCGCGGGCGCGCGGG - Intronic
1056406592 9:86281855-86281877 CGTGACCTCGGCAGGAGCCGGGG + Intronic
1061252893 9:129437063-129437085 CCTGACCGCGGCGTGCGTGCCGG + Intergenic
1203732016 Un_GL000216v2:99281-99303 TGGGACCGGGGCGGGCGACCGGG + Intergenic
1186350138 X:8732007-8732029 CAGGACCGCGCCGGGCACCCCGG + Exonic
1188248615 X:27863979-27864001 CGTGAAGGCGGCGCGCGCCCGGG + Intergenic
1190560725 X:51682739-51682761 CGTGACCGCGATGGCCGCGCAGG + Intergenic
1190563566 X:51710582-51710604 CGTGACCGCGATGGCCGCGCAGG - Intergenic
1197774640 X:130111066-130111088 GGCGACCGCGGCGGGCGGGCCGG - Intergenic
1200209929 X:154342623-154342645 CTTGACAGCGGCGGCCGCCGGGG + Intergenic
1200220923 X:154389469-154389491 CTTGACAGCGGCGGCCGCCGGGG - Intergenic