ID: 967863372

View in Genome Browser
Species Human (GRCh38)
Location 3:194170242-194170264
Sequence CACCACTCCCACCTTCATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967863362_967863372 25 Left 967863362 3:194170194-194170216 CCTCTTTCTGTATCTAGGATCCC No data
Right 967863372 3:194170242-194170264 CACCACTCCCACCTTCATGGTGG No data
967863365_967863372 5 Left 967863365 3:194170214-194170236 CCCCTTCTCCTGGGAGTCTTCTG No data
Right 967863372 3:194170242-194170264 CACCACTCCCACCTTCATGGTGG No data
967863366_967863372 4 Left 967863366 3:194170215-194170237 CCCTTCTCCTGGGAGTCTTCTGA No data
Right 967863372 3:194170242-194170264 CACCACTCCCACCTTCATGGTGG No data
967863368_967863372 -3 Left 967863368 3:194170222-194170244 CCTGGGAGTCTTCTGAAGCCCAC No data
Right 967863372 3:194170242-194170264 CACCACTCCCACCTTCATGGTGG No data
967863367_967863372 3 Left 967863367 3:194170216-194170238 CCTTCTCCTGGGAGTCTTCTGAA No data
Right 967863372 3:194170242-194170264 CACCACTCCCACCTTCATGGTGG No data
967863361_967863372 26 Left 967863361 3:194170193-194170215 CCCTCTTTCTGTATCTAGGATCC No data
Right 967863372 3:194170242-194170264 CACCACTCCCACCTTCATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967863372 Original CRISPR CACCACTCCCACCTTCATGG TGG Intergenic
No off target data available for this crispr