ID: 967864246

View in Genome Browser
Species Human (GRCh38)
Location 3:194177331-194177353
Sequence TGGAAGGCACAGATGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967864239_967864246 21 Left 967864239 3:194177287-194177309 CCAGGAATTTAGTCCAGTATATC No data
Right 967864246 3:194177331-194177353 TGGAAGGCACAGATGGAGGAAGG No data
967864240_967864246 8 Left 967864240 3:194177300-194177322 CCAGTATATCTTCATACGACCAA No data
Right 967864246 3:194177331-194177353 TGGAAGGCACAGATGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967864246 Original CRISPR TGGAAGGCACAGATGGAGGA AGG Intergenic
No off target data available for this crispr