ID: 967869753

View in Genome Browser
Species Human (GRCh38)
Location 3:194220306-194220328
Sequence GCTGCTGGTGTGGCCCAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967869749_967869753 18 Left 967869749 3:194220265-194220287 CCTAGGAGTGGGGATGCAAGAGC No data
Right 967869753 3:194220306-194220328 GCTGCTGGTGTGGCCCAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967869753 Original CRISPR GCTGCTGGTGTGGCCCAGCC CGG Intergenic
No off target data available for this crispr