ID: 967871292

View in Genome Browser
Species Human (GRCh38)
Location 3:194231983-194232005
Sequence GACTCATCTGTGTTGCAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967871292_967871308 27 Left 967871292 3:194231983-194232005 CCCGGCTGCAACACAGATGAGTC No data
Right 967871308 3:194232033-194232055 GAGGCATCACCTTACAGATAGGG No data
967871292_967871297 8 Left 967871292 3:194231983-194232005 CCCGGCTGCAACACAGATGAGTC No data
Right 967871297 3:194232014-194232036 ACTGGCCCCCGCCCCCGCCGAGG No data
967871292_967871307 26 Left 967871292 3:194231983-194232005 CCCGGCTGCAACACAGATGAGTC No data
Right 967871307 3:194232032-194232054 CGAGGCATCACCTTACAGATAGG No data
967871292_967871294 -10 Left 967871292 3:194231983-194232005 CCCGGCTGCAACACAGATGAGTC No data
Right 967871294 3:194231996-194232018 CAGATGAGTCCCGAAGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967871292 Original CRISPR GACTCATCTGTGTTGCAGCC GGG (reversed) Intergenic
No off target data available for this crispr