ID: 967875451

View in Genome Browser
Species Human (GRCh38)
Location 3:194265525-194265547
Sequence GGTGCTGCAGGCTGCACTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967875451_967875456 1 Left 967875451 3:194265525-194265547 CCGGCAGTGCAGCCTGCAGCACC No data
Right 967875456 3:194265549-194265571 GGCTCGCCTTCCTCTGCCCTGGG No data
967875451_967875455 0 Left 967875451 3:194265525-194265547 CCGGCAGTGCAGCCTGCAGCACC No data
Right 967875455 3:194265548-194265570 TGGCTCGCCTTCCTCTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967875451 Original CRISPR GGTGCTGCAGGCTGCACTGC CGG (reversed) Intergenic
No off target data available for this crispr