ID: 967883159

View in Genome Browser
Species Human (GRCh38)
Location 3:194315687-194315709
Sequence AGGTGCCGATGCACGGGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967883152_967883159 -5 Left 967883152 3:194315669-194315691 CCGCGGCCAGCATTAATTAGGTG No data
Right 967883159 3:194315687-194315709 AGGTGCCGATGCACGGGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967883159 Original CRISPR AGGTGCCGATGCACGGGGGC GGG Intergenic
No off target data available for this crispr