ID: 967884058

View in Genome Browser
Species Human (GRCh38)
Location 3:194321491-194321513
Sequence CCTGGGATGCAGAGGTTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967884051_967884058 16 Left 967884051 3:194321452-194321474 CCCAGTTACTCAGAGGCTGAGGC No data
Right 967884058 3:194321491-194321513 CCTGGGATGCAGAGGTTGCAGGG No data
967884048_967884058 24 Left 967884048 3:194321444-194321466 CCTGTAATCCCAGTTACTCAGAG 0: 6
1: 495
2: 6461
3: 72350
4: 164216
Right 967884058 3:194321491-194321513 CCTGGGATGCAGAGGTTGCAGGG No data
967884052_967884058 15 Left 967884052 3:194321453-194321475 CCAGTTACTCAGAGGCTGAGGCA No data
Right 967884058 3:194321491-194321513 CCTGGGATGCAGAGGTTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967884058 Original CRISPR CCTGGGATGCAGAGGTTGCA GGG Intergenic
No off target data available for this crispr