ID: 967885971 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:194333730-194333752 |
| Sequence | GCGTGCGTGCGGAGCCGTCA CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 967885971_967885977 | 7 | Left | 967885971 | 3:194333730-194333752 | CCGTGACGGCTCCGCACGCACGC | No data | ||
| Right | 967885977 | 3:194333760-194333782 | CACTCCGGCAAGTATCCCCCGGG | No data | ||||
| 967885971_967885973 | -8 | Left | 967885971 | 3:194333730-194333752 | CCGTGACGGCTCCGCACGCACGC | No data | ||
| Right | 967885973 | 3:194333745-194333767 | ACGCACGCCCGCATGCACTCCGG | No data | ||||
| 967885971_967885976 | 6 | Left | 967885971 | 3:194333730-194333752 | CCGTGACGGCTCCGCACGCACGC | No data | ||
| Right | 967885976 | 3:194333759-194333781 | GCACTCCGGCAAGTATCCCCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 967885971 | Original CRISPR | GCGTGCGTGCGGAGCCGTCA CGG (reversed) | Intergenic | ||