ID: 967885971

View in Genome Browser
Species Human (GRCh38)
Location 3:194333730-194333752
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967885971_967885973 -8 Left 967885971 3:194333730-194333752 CCGTGACGGCTCCGCACGCACGC No data
Right 967885973 3:194333745-194333767 ACGCACGCCCGCATGCACTCCGG No data
967885971_967885976 6 Left 967885971 3:194333730-194333752 CCGTGACGGCTCCGCACGCACGC No data
Right 967885976 3:194333759-194333781 GCACTCCGGCAAGTATCCCCCGG No data
967885971_967885977 7 Left 967885971 3:194333730-194333752 CCGTGACGGCTCCGCACGCACGC No data
Right 967885977 3:194333760-194333782 CACTCCGGCAAGTATCCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967885971 Original CRISPR GCGTGCGTGCGGAGCCGTCA CGG (reversed) Intergenic