ID: 967885972

View in Genome Browser
Species Human (GRCh38)
Location 3:194333741-194333763
Sequence AGTGCATGCGGGCGTGCGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967885972_967885985 30 Left 967885972 3:194333741-194333763 CCGCACGCACGCCCGCATGCACT No data
Right 967885985 3:194333794-194333816 ATGTGCCCGTATCCCTTCTAGGG No data
967885972_967885976 -5 Left 967885972 3:194333741-194333763 CCGCACGCACGCCCGCATGCACT No data
Right 967885976 3:194333759-194333781 GCACTCCGGCAAGTATCCCCCGG No data
967885972_967885984 29 Left 967885972 3:194333741-194333763 CCGCACGCACGCCCGCATGCACT No data
Right 967885984 3:194333793-194333815 AATGTGCCCGTATCCCTTCTAGG No data
967885972_967885977 -4 Left 967885972 3:194333741-194333763 CCGCACGCACGCCCGCATGCACT No data
Right 967885977 3:194333760-194333782 CACTCCGGCAAGTATCCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967885972 Original CRISPR AGTGCATGCGGGCGTGCGTG CGG (reversed) Intergenic