ID: 967885973

View in Genome Browser
Species Human (GRCh38)
Location 3:194333745-194333767
Sequence ACGCACGCCCGCATGCACTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967885968_967885973 26 Left 967885968 3:194333696-194333718 CCTGGCGCTTTTTCAGGCGTGCA No data
Right 967885973 3:194333745-194333767 ACGCACGCCCGCATGCACTCCGG No data
967885971_967885973 -8 Left 967885971 3:194333730-194333752 CCGTGACGGCTCCGCACGCACGC No data
Right 967885973 3:194333745-194333767 ACGCACGCCCGCATGCACTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967885973 Original CRISPR ACGCACGCCCGCATGCACTC CGG Intergenic
No off target data available for this crispr