ID: 967885974

View in Genome Browser
Species Human (GRCh38)
Location 3:194333752-194333774
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967885974_967885984 18 Left 967885974 3:194333752-194333774 CCCGCATGCACTCCGGCAAGTAT No data
Right 967885984 3:194333793-194333815 AATGTGCCCGTATCCCTTCTAGG No data
967885974_967885989 26 Left 967885974 3:194333752-194333774 CCCGCATGCACTCCGGCAAGTAT No data
Right 967885989 3:194333801-194333823 CGTATCCCTTCTAGGGGACCCGG No data
967885974_967885985 19 Left 967885974 3:194333752-194333774 CCCGCATGCACTCCGGCAAGTAT No data
Right 967885985 3:194333794-194333816 ATGTGCCCGTATCCCTTCTAGGG No data
967885974_967885986 20 Left 967885974 3:194333752-194333774 CCCGCATGCACTCCGGCAAGTAT No data
Right 967885986 3:194333795-194333817 TGTGCCCGTATCCCTTCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967885974 Original CRISPR ATACTTGCCGGAGTGCATGC GGG (reversed) Intergenic