ID: 967885977

View in Genome Browser
Species Human (GRCh38)
Location 3:194333760-194333782
Sequence CACTCCGGCAAGTATCCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967885972_967885977 -4 Left 967885972 3:194333741-194333763 CCGCACGCACGCCCGCATGCACT No data
Right 967885977 3:194333760-194333782 CACTCCGGCAAGTATCCCCCGGG No data
967885971_967885977 7 Left 967885971 3:194333730-194333752 CCGTGACGGCTCCGCACGCACGC No data
Right 967885977 3:194333760-194333782 CACTCCGGCAAGTATCCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967885977 Original CRISPR CACTCCGGCAAGTATCCCCC GGG Intergenic
No off target data available for this crispr