ID: 967885984

View in Genome Browser
Species Human (GRCh38)
Location 3:194333793-194333815
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967885982_967885984 -8 Left 967885982 3:194333778-194333800 CCGGGTCACCGTGTCAATGTGCC No data
Right 967885984 3:194333793-194333815 AATGTGCCCGTATCCCTTCTAGG No data
967885981_967885984 -7 Left 967885981 3:194333777-194333799 CCCGGGTCACCGTGTCAATGTGC No data
Right 967885984 3:194333793-194333815 AATGTGCCCGTATCCCTTCTAGG No data
967885978_967885984 6 Left 967885978 3:194333764-194333786 CCGGCAAGTATCCCCCGGGTCAC No data
Right 967885984 3:194333793-194333815 AATGTGCCCGTATCCCTTCTAGG No data
967885980_967885984 -6 Left 967885980 3:194333776-194333798 CCCCGGGTCACCGTGTCAATGTG No data
Right 967885984 3:194333793-194333815 AATGTGCCCGTATCCCTTCTAGG No data
967885975_967885984 17 Left 967885975 3:194333753-194333775 CCGCATGCACTCCGGCAAGTATC No data
Right 967885984 3:194333793-194333815 AATGTGCCCGTATCCCTTCTAGG No data
967885974_967885984 18 Left 967885974 3:194333752-194333774 CCCGCATGCACTCCGGCAAGTAT No data
Right 967885984 3:194333793-194333815 AATGTGCCCGTATCCCTTCTAGG No data
967885979_967885984 -5 Left 967885979 3:194333775-194333797 CCCCCGGGTCACCGTGTCAATGT No data
Right 967885984 3:194333793-194333815 AATGTGCCCGTATCCCTTCTAGG No data
967885972_967885984 29 Left 967885972 3:194333741-194333763 CCGCACGCACGCCCGCATGCACT No data
Right 967885984 3:194333793-194333815 AATGTGCCCGTATCCCTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type