ID: 967887503

View in Genome Browser
Species Human (GRCh38)
Location 3:194343070-194343092
Sequence CTGTGCAAAGAGCAGGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 326}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967887503_967887510 14 Left 967887503 3:194343070-194343092 CCTGGCACCTGCTCTTTGCACAG 0: 1
1: 0
2: 3
3: 39
4: 326
Right 967887510 3:194343107-194343129 GTGCAGCCACAGAGATGAGATGG 0: 1
1: 1
2: 1
3: 40
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967887503 Original CRISPR CTGTGCAAAGAGCAGGTGCC AGG (reversed) Intronic
900379903 1:2378544-2378566 CCGTGCAGTGAGCAGGTGCTCGG + Intronic
900796403 1:4711279-4711301 GTTTGCAAAGTGCAAGTGCCTGG + Intronic
901237264 1:7673846-7673868 CTCTGCACAGAGTAGGGGCCTGG + Intronic
902286157 1:15409923-15409945 CTGCGCTGAGAGCAGGGGCCCGG + Exonic
902519476 1:17007890-17007912 CTGTGCCCACAGCAGCTGCCTGG - Intronic
902536844 1:17124076-17124098 CAGTGCTTAGCGCAGGTGCCTGG - Intergenic
902549509 1:17210918-17210940 CCCAGCACAGAGCAGGTGCCCGG - Intronic
902561871 1:17282705-17282727 CTGTGCAATGAGAAGGTAACTGG - Intronic
902821756 1:18947684-18947706 TTCTCCAAAGAGCAGGGGCCTGG + Intronic
902980952 1:20122678-20122700 CTGTGGAAAGAGAAACTGCCAGG - Intergenic
903334608 1:22616680-22616702 CAGTGCAGAGGGCACGTGCCTGG - Intergenic
903479016 1:23639630-23639652 CTGAGCAAGGAGCTGGTGCCAGG - Intronic
903668543 1:25022332-25022354 GTGGGCGAGGAGCAGGTGCCTGG + Intergenic
905067926 1:35199233-35199255 CTGTGCAAAGAGCCGGGGCGGGG - Intergenic
905294670 1:36946693-36946715 CTGTGAAATGAGAAGGTGCATGG - Intronic
905910038 1:41647431-41647453 CTGTGGAAACAGCTTGTGCCCGG - Intronic
907485759 1:54777054-54777076 CTGTTCAGACAGCAGGGGCCAGG - Intergenic
907629848 1:56069526-56069548 CAGTGGAAAGAGCAGGAGCAAGG + Intergenic
907666328 1:56436525-56436547 CTGGGCACAGAGTAGGTGCCAGG - Intergenic
908741820 1:67336737-67336759 CTCTGCACCGTGCAGGTGCCTGG - Intronic
908774763 1:67628946-67628968 GTGGGCAAAGGGCAGGTTCCAGG - Intergenic
908819658 1:68071345-68071367 CTTTTCAAAGAGCAAGTGCCTGG + Intergenic
909600491 1:77456527-77456549 CTGGGCAGAGAGCATGTGCCAGG + Intronic
910707192 1:90142297-90142319 CAGAGCAAAGAGCAGGAGCTGGG + Intergenic
910826445 1:91413118-91413140 TTGTGGAAAGAGCAGGAGACTGG - Intergenic
911141405 1:94506708-94506730 CTGTCCAAAGAGAAGATTCCAGG + Intronic
913389621 1:118295898-118295920 CTGTGGAGAGAGAAGGTACCAGG - Intergenic
915322610 1:155063999-155064021 CCGCGCAAAGAGCGGGTGGCGGG - Intronic
915367005 1:155322227-155322249 CTGTCCGGTGAGCAGGTGCCAGG - Exonic
915906750 1:159884320-159884342 TTGTGAAATGAGCATGTGCCTGG + Intronic
916207336 1:162328091-162328113 CTGTGGAAAGAGCATGGGCTTGG - Intronic
917854867 1:179091874-179091896 GTGTGCACAGATCATGTGCCTGG + Intronic
919249227 1:195030889-195030911 CTCTGCACCGAGCAAGTGCCAGG + Intergenic
919409880 1:197229369-197229391 CTGAGCAAAGAGGAAATGCCAGG - Intergenic
920667505 1:207974091-207974113 CTGTCCAAAGAGCAGGTTGCTGG + Intergenic
920851082 1:209628103-209628125 GTGTGCAAGGAGCATGTGCAGGG - Exonic
920967944 1:210716796-210716818 CTCTGCAAAGAGTAGGTGCTGGG + Intronic
921071003 1:211657226-211657248 CTGTGCAAAAGGAAGATGCCAGG + Intergenic
921929849 1:220746359-220746381 CTGTGCATGCAGCAGGTGGCGGG - Intergenic
922212684 1:223497779-223497801 CAGTGCAAAAAGCTGGAGCCAGG + Intergenic
922232138 1:223696661-223696683 CAGAGAAGAGAGCAGGTGCCGGG - Intergenic
922792409 1:228317613-228317635 CTGTGCCACGAGCTGGTGCCTGG + Exonic
923917852 1:238529527-238529549 CCTTGCACAGAGCTGGTGCCTGG - Intergenic
1064080157 10:12301891-12301913 CTGGGCAAGGAGCAGGTTACAGG + Intergenic
1064268430 10:13843821-13843843 TTGTGCAAGGAGGTGGTGCCTGG + Intronic
1064280684 10:13948591-13948613 CTGAGCAGAGAGCAGGTGGTGGG + Intronic
1066107210 10:32166561-32166583 AGGTGCAAAGAGCAGCTGCTGGG + Intergenic
1067247294 10:44557551-44557573 CTGTCCAAACAGCAAGTGCAGGG - Intergenic
1068935516 10:62632217-62632239 CAGTGGAAAGAGCAGGGGCTGGG - Intronic
1069899425 10:71698635-71698657 CTATGAAAAGAGCAGGGGTCAGG - Intronic
1070586345 10:77769735-77769757 AAGTGGAAAGAGCAGGAGCCAGG - Intergenic
1071260539 10:83915226-83915248 CTGTGGCAAGTGCAGGAGCCAGG + Intergenic
1071368096 10:84922058-84922080 CTTAGTAAAGAGCAGGTGCAGGG + Intergenic
1072661647 10:97367016-97367038 CTGTGCACTGAGCAGGGGCGGGG - Intronic
1073300659 10:102469266-102469288 CTGGGCAGATTGCAGGTGCCTGG + Intronic
1074672200 10:115804455-115804477 AAGAGCAAAGAGCAGGAGCCAGG - Intronic
1075925432 10:126248052-126248074 CTGTGCCACCAGCAGGTGCAGGG - Intronic
1076704766 10:132295090-132295112 CAGTGCACAGAGCAGGTGCACGG + Intronic
1076761534 10:132608343-132608365 CTGTGCAGAGAGTGGGTGCTGGG + Intronic
1077160752 11:1111771-1111793 CTTGGCCCAGAGCAGGTGCCTGG + Intergenic
1077184469 11:1230048-1230070 CCCTGCACAGAGCAGGTGCCAGG - Exonic
1079156678 11:17954442-17954464 CTGTGGAAAGTGTAGGGGCCTGG + Intronic
1081754718 11:45536385-45536407 CTGTGGAGAGAGGAGATGCCTGG - Intergenic
1081771633 11:45653817-45653839 CTGTGAAAGAAGCATGTGCCTGG - Intronic
1083796267 11:65018548-65018570 CTGGGCAAGGAGCGGGTGACAGG - Intronic
1084486470 11:69451053-69451075 CTCTCCAAAGAACAGCTGCCAGG + Intergenic
1084775271 11:71370713-71370735 CTGTGCAAAGAGCACCAGGCAGG - Intergenic
1085765215 11:79276498-79276520 ATGTGCAAAGAGCTGCTGCTAGG + Intronic
1086402617 11:86473081-86473103 CTGTGCACAGAGCAGGGAGCAGG + Intronic
1086947571 11:92858329-92858351 CTGTGCACATAGCAGGTGGATGG + Intronic
1088013753 11:105035072-105035094 CTGTTCCAAGAACAGGTCCCTGG - Intronic
1088014762 11:105045256-105045278 CTGTTCCAAGAACAGGTCCCTGG - Intronic
1089692587 11:120196109-120196131 CTGTGCAAAGAGCTGGTCGGGGG - Intergenic
1089898733 11:121959324-121959346 CAGTGGAAAGTGCCGGTGCCTGG + Intergenic
1090189851 11:124760569-124760591 CGGTGCAACGTGCAGGCGCCCGG - Intronic
1090922983 11:131223430-131223452 CTGAGCAAGGATCTGGTGCCTGG - Intergenic
1091667340 12:2428860-2428882 CTGTGCAAAGAGGAGAAGCTGGG + Intronic
1092217782 12:6694909-6694931 GTGTGCAAGGGGCAGGAGCCAGG + Exonic
1093558480 12:20508126-20508148 CAGTGCAATGAGAATGTGCCTGG - Intronic
1093939846 12:25041105-25041127 CAGAGCAAGGAGCCGGTGCCAGG + Intronic
1096186030 12:49581108-49581130 GTGTGCAGAGAGCAGGGGCAGGG + Intronic
1097495260 12:60323472-60323494 CATTGCAAAGAGCTGGTGACAGG - Intergenic
1102165230 12:110800821-110800843 ATATGCTAAGAGCAGGTCCCAGG - Intergenic
1103976924 12:124708704-124708726 CTGATCACAGAGGAGGTGCCTGG + Intergenic
1106136787 13:26979546-26979568 CTCTGCAGAGAGCCGGTGTCAGG - Intergenic
1106348024 13:28898429-28898451 CTGTGGAAAGAGCAGGGCTCTGG - Intronic
1106788297 13:33129358-33129380 CTGGGCAGAGAGCAGGTCCCTGG - Exonic
1107028669 13:35829136-35829158 CTATGCAGGGAGCAGGGGCCTGG - Intronic
1108394100 13:49976455-49976477 CTGTGCAAAGAGAAAATGCTAGG + Intergenic
1108703940 13:52968161-52968183 CTGTGCAAAGCTGCGGTGCCTGG - Intergenic
1112474843 13:99722031-99722053 CTGTGCTAAGAGCAAATGCAGGG - Intronic
1115200833 14:30852627-30852649 CTGTTTAAATAACAGGTGCCTGG - Intergenic
1116070269 14:40035076-40035098 CTGTCCAAATAGCAGATGACAGG + Intergenic
1116924519 14:50620437-50620459 CTGTGAGAAGAGCAGGTTTCAGG + Intronic
1117634887 14:57731438-57731460 CAGTGGAAAGGGCAGGTGTCTGG - Intronic
1117658666 14:57982405-57982427 CTGTGGACATAGCTGGTGCCTGG - Intergenic
1118858556 14:69643600-69643622 GTGAGCAAACAGCAGGTGCTTGG + Intronic
1121549360 14:94787212-94787234 CTTTGAACTGAGCAGGTGCCCGG + Intergenic
1121584752 14:95055578-95055600 CTGTACAAGGAGCAGGTGATGGG + Intergenic
1121723302 14:96127358-96127380 CTGTGCAAAGGGCAGACGCCTGG - Intergenic
1122318600 14:100840050-100840072 CCGTGTACAGAGCAGGTGCTGGG + Intergenic
1122402129 14:101473758-101473780 CTGTGCAAAGACCCAGTGCTGGG + Intergenic
1122409587 14:101519048-101519070 CTTTGCATACAGCAGGTCCCGGG + Intergenic
1124158034 15:27245207-27245229 CTGGGCAGGTAGCAGGTGCCAGG + Intronic
1127850397 15:62907135-62907157 CTGTGGTAGGAGCTGGTGCCTGG - Intergenic
1128214232 15:65923199-65923221 ATGTACAAAGAGCAGGAGGCAGG + Intronic
1128248112 15:66146876-66146898 ATGGGCAAAGAGCAGGTACAAGG - Intronic
1128291702 15:66483129-66483151 CTGTGCAAAGGGCGTCTGCCTGG - Intronic
1128388138 15:67165107-67165129 CTGTGGGGACAGCAGGTGCCAGG + Intronic
1128805711 15:70529560-70529582 CTGTGCACATAGGAGGTGCCAGG - Intergenic
1131905689 15:97139526-97139548 CAGTGTAAACAGCAGGGGCCAGG - Intergenic
1132467735 16:85264-85286 AGGTGCACAGAGCAGGTCCCTGG + Intronic
1133389442 16:5397394-5397416 CAGTGCAGAGAGCACCTGCCAGG - Intergenic
1134040855 16:11067334-11067356 CTGTTCTAAGAGCAGGTGACGGG + Intronic
1135071935 16:19359820-19359842 GTGTGCAGAGAGGAAGTGCCTGG + Intergenic
1136077045 16:27824339-27824361 CTGTGGAAAGAGCAGGGGTTTGG - Intronic
1136266981 16:29127656-29127678 CTAAGCAAAGAGCAGGGGCAGGG + Intergenic
1137505635 16:49051735-49051757 GTGTGCCAGGAGCAGCTGCCAGG + Intergenic
1137764616 16:50968250-50968272 GGGTGCAGAGGGCAGGTGCCAGG + Intergenic
1137865655 16:51893449-51893471 CTGTGCAAAGAGCAGATTACAGG + Intergenic
1138096876 16:54218789-54218811 CTGGGGAAATAGCAGGGGCCAGG + Intergenic
1138399223 16:56731814-56731836 CTGTGCAAAAAACAGGGGCCAGG - Intronic
1138778119 16:59749837-59749859 CTGTGGGAAGAGCAGCTGCAGGG + Intronic
1139447151 16:67004937-67004959 CTTTGCAAAGAGCAGCTACTAGG - Intronic
1141146402 16:81533273-81533295 CTGAGCATCTAGCAGGTGCCAGG - Intronic
1141647796 16:85376760-85376782 CTGGGCAGAGAGCAGGGGGCTGG + Intergenic
1141848036 16:86624242-86624264 CTGTACAGAGAGCAGGTGCAAGG - Intergenic
1142070269 16:88087979-88088001 CTAAGCAAAGAGCAGGGGCACGG + Intronic
1142326622 16:89419747-89419769 CTTTGCAAAACGCATGTGCCAGG - Intronic
1142982210 17:3678840-3678862 CTGTGCGGTGAGCAGGTGCCTGG - Intronic
1143331747 17:6142045-6142067 CCGTGAAAAGTTCAGGTGCCAGG + Intergenic
1143405931 17:6677260-6677282 CTGGAGAAAGAGCAGGAGCCAGG - Intergenic
1144342166 17:14318859-14318881 CTGCGAAAAGAGCATTTGCCAGG + Intronic
1144353825 17:14425573-14425595 CTTTAAAAAGGGCAGGTGCCCGG + Intergenic
1144713830 17:17420787-17420809 ATGTTGAAAGAGCAGGGGCCTGG - Intergenic
1148774415 17:50087644-50087666 CAGGACAAACAGCAGGTGCCTGG + Intronic
1150175450 17:63049989-63050011 CTGTGAGAGGAGCAGGTTCCTGG + Intronic
1150890929 17:69148891-69148913 CTCTGTAAAGAGCAGGAGCTGGG - Exonic
1151475644 17:74343047-74343069 CTGGGCACAGACCAGGAGCCTGG + Exonic
1151499880 17:74481829-74481851 CTGTGGTAAGTGCAGGAGCCCGG + Exonic
1151557027 17:74851839-74851861 CTGAACAAACAGCAGGTGTCAGG - Intronic
1152315635 17:79578835-79578857 CTGGGCAAAGACCCTGTGCCAGG - Intergenic
1152830930 17:82496725-82496747 CTGTGGAAGGCGCAGGGGCCAGG + Intergenic
1153330186 18:3865980-3866002 CTGTGGAAAGAGCACTAGCCTGG + Intronic
1153519430 18:5937965-5937987 GTGTGCAGAGAGCAGGTGCTTGG + Intergenic
1153781602 18:8499976-8499998 CTGTTCTCAGAGCAGGTCCCTGG - Intergenic
1156126639 18:33913819-33913841 GTGTGAAAAAAGCAGGTTCCTGG + Intronic
1156263728 18:35467691-35467713 CTGTGCAAGTGGCAGCTGCCTGG - Intronic
1157300984 18:46479014-46479036 CTTGGAAAAGAGCAGGTGACAGG - Intronic
1157487526 18:48099158-48099180 CTCTGCAAAGAACTGTTGCCAGG + Intronic
1159637569 18:70824130-70824152 CTGTGCTGAAAGCAGGGGCCAGG + Intergenic
1159809326 18:72997750-72997772 GTGTTCAAAGAGCAATTGCCTGG + Intergenic
1160137110 18:76281863-76281885 CTGTGAACGGAGCAGATGCCCGG - Intergenic
1160959504 19:1713051-1713073 CTGGGCACAGAGCAGGGCCCTGG + Intergenic
1161335048 19:3708516-3708538 CTGGGCAGGCAGCAGGTGCCAGG - Intronic
1163133423 19:15291223-15291245 CTAGCCAAACAGCAGGTGCCTGG + Intronic
1163749087 19:19064672-19064694 CAGGGCAGAGGGCAGGTGCCAGG - Intronic
1164608645 19:29617638-29617660 CTGTCCAAGGAGCAGGACCCTGG + Intergenic
1164883274 19:31754583-31754605 GAGAGCAAGGAGCAGGTGCCAGG + Intergenic
1165708548 19:37993268-37993290 CTGTGCCAAGAGCTGGTTCAAGG - Intronic
1165739533 19:38197175-38197197 CCCTGCACAGAGGAGGTGCCGGG + Intronic
1166740633 19:45112805-45112827 CGGGGCACAGAGCAGGTGCTGGG + Intronic
1167605258 19:50478574-50478596 CTGTTCACTGAGCAGATGCCAGG - Intronic
1168379076 19:55905113-55905135 CTGTGGAAGGTGCAGGTGCAAGG + Intronic
925153814 2:1635214-1635236 CTGTGCACAGAGGACGTGCTAGG - Intronic
925940271 2:8810311-8810333 CTGTGCTAAGTGCAGGTACAGGG + Intronic
926063547 2:9820010-9820032 CTGTGTGAAGAGCAGGCTCCAGG - Intergenic
926289515 2:11517314-11517336 CAGTCCAAAGAGCAGGTGCCTGG - Intergenic
927962740 2:27250810-27250832 CTGTGTAAAGAGCTGGGGCTGGG + Intergenic
928068365 2:28189470-28189492 CTGTGCAACTACCATGTGCCAGG - Intronic
933720312 2:85393478-85393500 CTACACAAAGAGCAGGTGCCAGG - Intergenic
934712053 2:96522747-96522769 CTGAGCAAAGGGCAGGAGGCAGG + Intergenic
935639192 2:105274708-105274730 GTATGCAAAGTGCAAGTGCCTGG + Intronic
935681564 2:105642756-105642778 AGGTGCAAAGAGTAGGTGCAAGG + Intergenic
935695060 2:105764113-105764135 CTCTGCAAAGCGAAGCTGCCAGG - Intronic
936946113 2:117932539-117932561 CTGTGGAAAGAGCAGGGCACAGG - Intronic
937352932 2:121178468-121178490 CTGTGCAGTCAGAAGGTGCCTGG + Intergenic
937469161 2:122160695-122160717 ATGTACAAAGAGCAAGTGACTGG - Intergenic
938579939 2:132636563-132636585 CAGTGCAAACAGCACCTGCCTGG + Intronic
940046228 2:149413234-149413256 CTGGGCAAGGAACAGCTGCCTGG - Intronic
940311580 2:152284881-152284903 ATGTGCAAGGTGCAAGTGCCAGG - Intergenic
940376821 2:152967097-152967119 CGATGCCAAGAGCAGGAGCCTGG + Intergenic
940494350 2:154406340-154406362 CTGTGCAAAGAGCAGATTAGAGG - Intronic
940615811 2:156047637-156047659 CTGTGGAAAAAGCAGTTTCCCGG - Intergenic
941001692 2:160209006-160209028 CTGTGGGAAGAGCAAGTGCAAGG + Intronic
941574902 2:167217382-167217404 CTGTGCTCAGAGCTGATGCCTGG + Intronic
946324859 2:218980130-218980152 CAGTGCAAACCGCAAGTGCCTGG - Intergenic
947588784 2:231372806-231372828 CTGTGGGCAGATCAGGTGCCTGG - Intronic
947689346 2:232120504-232120526 CAGTGCCAAGTGCAGGTGACGGG + Intronic
947947713 2:234120765-234120787 CTGAGCAAAGAGTAGGAACCTGG + Intergenic
948220959 2:236269525-236269547 CTGGGCACAGAGCAGGAGCCAGG - Intergenic
948459769 2:238123537-238123559 CTGTCCACAGAGCAGGGGCCGGG - Intronic
948575754 2:238948455-238948477 CTCTGCAGAGAGCACCTGCCAGG - Intergenic
1169948043 20:11010599-11010621 CTGAGCAGAGACCAGGTTCCTGG - Intergenic
1171290462 20:23979940-23979962 CTTTGCACAGAACAGGTGGCAGG - Intergenic
1172698937 20:36840897-36840919 CTGTGCTAAGCGCAGGGGCAGGG + Intronic
1174061935 20:47839159-47839181 CTGAGGAAAGAGGAGGAGCCAGG + Intergenic
1174069573 20:47890072-47890094 CTGAGGAAAGAGGAGGAGCCAGG - Intergenic
1174289562 20:49498244-49498266 CTGTGGAAATAGCAGGAGCAAGG - Intergenic
1174407199 20:50310171-50310193 CTGAGCAAAGGGCAGGGGCGGGG - Intergenic
1174854160 20:54027015-54027037 CTCAGTAAAGAGCAGATGCCTGG + Intronic
1175265300 20:57699533-57699555 CTGTGCAACTACCAGGTGCCAGG + Intronic
1176326558 21:5506824-5506846 ATGTGAAAAGAGCCGGTTCCCGG + Intergenic
1176331148 21:5549381-5549403 ATGTGAAAAGAGCTGGTTCCCGG - Intergenic
1176396609 21:6271570-6271592 ATGTGAAAAGAGCTGGTTCCCGG + Intergenic
1176401199 21:6314127-6314149 ATGTGAAAAGAGCCGGTTCCCGG - Intergenic
1176435958 21:6674977-6674999 ATGTGAAAAGAGCCGGTTCCCGG + Intergenic
1176440548 21:6717534-6717556 ATGTGAAAAGAGCTGGTTCCCGG - Intergenic
1176447324 21:6831434-6831456 CTGAGCACAGTGCAGGTGCTGGG + Intergenic
1176460220 21:7002047-7002069 ATGTGAAAAGAGCCGGTTCCCGG + Intergenic
1176464810 21:7044603-7044625 ATGTGAAAAGAGCTGGTTCCCGG - Intergenic
1176483781 21:7383825-7383847 ATGTGAAAAGAGCCGGTTCCCGG + Intergenic
1176488371 21:7426382-7426404 ATGTGAAAAGAGCTGGTTCCCGG - Intergenic
1176825492 21:13696460-13696482 CTGAGCACAGTGCAGGTGCTGGG + Intergenic
1176997552 21:15574387-15574409 CTTTTCAAAGAGCTGGTGCTTGG - Intergenic
1177284198 21:19026625-19026647 ATGTGCAAATAGCAGGTGTTCGG + Intergenic
1178954433 21:37009902-37009924 CTCTGCAAAGAGCGGGCTCCGGG - Intronic
1179418565 21:41217670-41217692 ATGTGAAAAGAGCAAGGGCCGGG - Intronic
1179507655 21:41852491-41852513 CTTTGCCAAAACCAGGTGCCTGG - Intronic
1179575358 21:42305129-42305151 CAGTGCAAAAAGCCGCTGCCTGG + Intergenic
1180161315 21:45999806-45999828 GTGGACAAAGAGCTGGTGCCAGG + Intronic
1180612336 22:17106127-17106149 CTGTGCAAATAGCACATGCCAGG - Intronic
1182153213 22:28045551-28045573 CTGAGCACCTAGCAGGTGCCAGG - Intronic
1182661095 22:31925852-31925874 CTAAGCAAGGAGCAGGTGACAGG + Intergenic
1183422377 22:37719366-37719388 CTTTGCTGAGAGCAGGTGGCTGG + Intronic
1183598575 22:38826841-38826863 CTGGGCATGCAGCAGGTGCCTGG - Intronic
1184003675 22:41693623-41693645 CTGTGGAGAGAGCAGGTTCTGGG - Exonic
1184150689 22:42636647-42636669 CTGAGCACAGAGTAGGTGCTGGG + Intronic
1184224795 22:43123351-43123373 CTGTGCTGACAGCAGGTGCCTGG + Intronic
1184406586 22:44304080-44304102 CAGGGCCCAGAGCAGGTGCCAGG - Intronic
1184493581 22:44824512-44824534 CTGTGCATACAGCAGGGACCCGG - Intronic
1184915687 22:47567402-47567424 CTTTGCAGAGGGCAGATGCCTGG - Intergenic
1185298160 22:50064279-50064301 CTTCACAAAGAGCAGGTGCCAGG + Intronic
950542095 3:13618813-13618835 GTGTGAGAAGGGCAGGTGCCTGG + Intronic
951733024 3:25831858-25831880 CTGTGGTAAGGGCAGCTGCCTGG - Intergenic
954108305 3:48420766-48420788 CTGTGCTCTGTGCAGGTGCCAGG - Exonic
954923957 3:54216194-54216216 CTCTGCAAAGAGTGGGTGTCAGG - Intronic
956345919 3:68278670-68278692 CTGTGCTAAGAAAAGGTGCAAGG - Intronic
958880635 3:99665132-99665154 AAGTCCAAGGAGCAGGTGCCAGG + Intronic
959378041 3:105608840-105608862 GTGTTGAAAGAGCAGGGGCCTGG + Intergenic
959991894 3:112639573-112639595 CTGAGCAAAGACCAGCAGCCAGG - Exonic
960737562 3:120797368-120797390 TTGTGAAAAGGGCAGGTCCCAGG - Intergenic
961657580 3:128451933-128451955 CAGTGCAGGGAGCAGGTGTCTGG - Intergenic
961818237 3:129562096-129562118 GGGTACAAAGAGAAGGTGCCAGG + Intronic
962873381 3:139517557-139517579 CTGTGCAAAGAGGGGGATCCTGG + Exonic
964620476 3:158716011-158716033 CGGTGCACATAGCAGGTGCGGGG - Intronic
964703315 3:159592547-159592569 ATGTGCAAAGACAAGGTGGCAGG - Intronic
967111347 3:186296829-186296851 ATGTGTAATGAGCAGATGCCTGG + Intronic
967743442 3:193028497-193028519 CTTTACAAAGTGCTGGTGCCTGG - Intergenic
967758124 3:193193404-193193426 GAGTGCACAGAGCAGGTGCTTGG - Intergenic
967887503 3:194343070-194343092 CTGTGCAAAGAGCAGGTGCCAGG - Intronic
968282054 3:197484662-197484684 CTGTGCAAAGAGCAGAGAGCAGG + Intergenic
968415157 4:425827-425849 CTCTGTAAAGAGCAGGCGCTGGG - Intronic
968589707 4:1451198-1451220 GTGTGGACAGAGCAGGTGCTCGG + Intergenic
968679605 4:1908045-1908067 CTGTGCTAAGAGCAGGTGTAGGG + Intronic
968908517 4:3465259-3465281 CTGAGCGGAGAGGAGGTGCCAGG - Intronic
969124443 4:4936014-4936036 CTGGGCACATAGGAGGTGCCAGG - Intergenic
969339630 4:6532029-6532051 CTTTGCAAAGGGCAGGAGGCTGG + Intronic
969486284 4:7474142-7474164 CTGAGCGCTGAGCAGGTGCCAGG - Intronic
970429376 4:15974789-15974811 CAGTGCAAAGAGAAGGTGCTAGG - Intronic
970518972 4:16863546-16863568 CTCTGCAAGGAGCTGGAGCCAGG + Intronic
970991384 4:22217426-22217448 TAGTGCAGAGAGCAGGTGTCTGG - Intergenic
971146431 4:23981555-23981577 CTGACCAAAGAGAAGGGGCCAGG + Intergenic
972058924 4:34842463-34842485 CTGTGTAAAGATCAAGTGCACGG - Intergenic
976999109 4:91473316-91473338 CTGTGCAAAGAGCTGCTTCATGG - Intronic
977284439 4:95084979-95085001 CTATTGAAAGAGCTGGTGCCCGG + Intronic
984646441 4:182225469-182225491 CACTGAAAAGATCAGGTGCCAGG - Intronic
984771739 4:183442672-183442694 TTGTGCAAAAACCAGGTGCTTGG - Intergenic
985380158 4:189385295-189385317 CTGTGGAATGACCAGGAGCCAGG + Intergenic
985704607 5:1393092-1393114 CTGTGCTAACTGCAGCTGCCTGG + Exonic
985729911 5:1541291-1541313 CTGTGCACACAGCAGGGCCCAGG - Intergenic
986026810 5:3858763-3858785 CTGACCACAAAGCAGGTGCCAGG + Intergenic
988540298 5:32102366-32102388 CTGGCAAAAGAGCAGGTCCCAGG - Intronic
989520587 5:42396237-42396259 CTGAGACCAGAGCAGGTGCCAGG - Intergenic
990269387 5:54119118-54119140 CTGTGCAAAGAGCCGTTGGAAGG - Intronic
990415789 5:55585271-55585293 CTGTGCAAGAAGCAGGTGCAGGG + Intergenic
993598042 5:89884237-89884259 CTGTGGTAAGAGCATGTACCTGG + Intergenic
994762321 5:103870641-103870663 CTGTGCAAAAAACAGATGCCAGG - Intergenic
995924343 5:117352523-117352545 CTGTGGAAAGAGCAGATGCTCGG + Intergenic
996992655 5:129654412-129654434 CTGTGCAAATGGCAGGTGCCAGG + Exonic
997597536 5:135117091-135117113 CTGGGCACACAGCTGGTGCCTGG - Intronic
998132079 5:139656277-139656299 CTGTGGCAAGAGCAGGGGCCAGG - Intronic
998388011 5:141769353-141769375 CTCTGCAATAAGCAGCTGCCTGG - Intergenic
998396066 5:141818880-141818902 CTGTGCAAAGATCCTGTGGCAGG + Intergenic
998475135 5:142414069-142414091 ATGAGCAAAGGGCAGGTGACAGG - Intergenic
1000970774 5:167711744-167711766 CACTGCAAAGAACAGGTGGCTGG - Intronic
1002845263 6:939659-939681 CTGTGCAAAGTACAGCTGCCAGG - Intergenic
1003468837 6:6409547-6409569 CAGTGCAAAGGGGAGGGGCCAGG - Intergenic
1003816480 6:9846970-9846992 CTGAGCAAAGATCACATGCCAGG - Intronic
1003954710 6:11151013-11151035 CTGTGAAAAGAGGAGGTGGTGGG - Intergenic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1006428860 6:33982914-33982936 CTGTCCAAAGGGGAGCTGCCAGG + Intergenic
1006668749 6:35716620-35716642 CTGAGTACAGAGCATGTGCCTGG - Intronic
1007419796 6:41712683-41712705 CTGTTGATAGAGCCGGTGCCAGG + Intronic
1007615911 6:43179740-43179762 CTGTGCACTGGGCAGGTTCCTGG + Exonic
1008412742 6:51199694-51199716 CTGTGCAAATACAAGGTGTCAGG - Intergenic
1009941030 6:70288145-70288167 CTGTGGGAAGAGCAGGTGTCAGG - Intronic
1011304425 6:85910879-85910901 CTTTGCAACGTGCAGCTGCCAGG - Intergenic
1011722970 6:90177976-90177998 CTCAGCACAGAGCAGGTACCCGG + Intronic
1013661907 6:112306630-112306652 CTGGGCACAGAGCAGGTGCTCGG + Intergenic
1016845097 6:148561775-148561797 TTGTGCACATAGCAGGTGCCGGG + Intergenic
1017042672 6:150320120-150320142 CTGTGTGACGAGCATGTGCCAGG - Intergenic
1018002218 6:159589387-159589409 GTGTGTAAAGAGCAGGAGGCTGG - Intergenic
1019493579 7:1326028-1326050 CCGTCCAAAGAGCAGGGACCTGG - Intergenic
1019923946 7:4180201-4180223 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1019923957 7:4180251-4180273 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1019923968 7:4180301-4180323 CTGGGCATAGAGCTGGAGCCAGG - Intronic
1019923973 7:4180326-4180348 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1019923979 7:4180351-4180373 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1019923985 7:4180376-4180398 CTGGGCATAGAGCTGGAGCCAGG - Intronic
1019923990 7:4180401-4180423 CTGGGCATAGAGCTGGAGCCAGG - Intronic
1019924006 7:4180476-4180498 CTGGGCATAGAGCTGGAGCCAGG - Intronic
1019924015 7:4180526-4180548 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1020376763 7:7495998-7496020 CTGTGCAAAGATCCTGTGGCAGG - Intronic
1020430651 7:8113391-8113413 CTGTCCCCACAGCAGGTGCCTGG - Exonic
1021690169 7:23223367-23223389 CCGTGCAAAGTGTAGGAGCCAGG + Intergenic
1022329298 7:29362393-29362415 CTGGGCACAGACCATGTGCCAGG - Intronic
1023020367 7:36006630-36006652 CTTTGCAATGAGGAGCTGCCTGG - Intergenic
1023601165 7:41883032-41883054 TTGTGCAAAGATCGAGTGCCTGG - Intergenic
1024240743 7:47433677-47433699 CTGTGGAAAGTGCAGGTTCTAGG - Intronic
1025232524 7:57212005-57212027 CTGAGGAAAGAGGAGGAGCCAGG - Intergenic
1025255142 7:57379577-57379599 CTGTGCAAAGGGCCTGTGGCAGG + Intergenic
1027174191 7:75892983-75893005 CTGTGCACAGAACTGGGGCCAGG + Intergenic
1029114743 7:98231374-98231396 CTGTTCACAGAACAGGCGCCCGG + Intronic
1029282630 7:99446226-99446248 CTGTGCTAACAGAAGGTGGCTGG - Intronic
1030076722 7:105743267-105743289 CTGTGCCAAGAACTGGGGCCAGG + Intronic
1031948710 7:127868916-127868938 CAGTGCAAAGAACTGGCGCCTGG - Intronic
1034864624 7:154630477-154630499 CTGTGGAAAGACCAGGTACATGG + Intronic
1035302141 7:157904496-157904518 CAGTGCCCTGAGCAGGTGCCGGG + Intronic
1036581025 8:10076199-10076221 CTGTGCAACTGGCAGGAGCCAGG - Intronic
1037274501 8:17163204-17163226 CTTTGGAAAGAGCTGCTGCCTGG + Intronic
1037917770 8:22783038-22783060 TTCTGCATGGAGCAGGTGCCTGG - Intronic
1038779762 8:30559997-30560019 CTGTGGAAAGAACAGGCCCCTGG + Intronic
1039778533 8:40760804-40760826 CTGTGCAACTTGCAGGTGCATGG - Intronic
1039978000 8:42383495-42383517 CTGTGCAATGTGCTGGTGCAGGG + Intergenic
1040374010 8:46805771-46805793 TTGTGCAGGGAGGAGGTGCCTGG - Intergenic
1042719444 8:71811353-71811375 CTGAGCAACGACCACGTGCCTGG - Intergenic
1042778402 8:72461604-72461626 CTGTGTAAAGATCATGTCCCAGG - Intergenic
1044533964 8:93338783-93338805 TGGTGCAAGGAGCAGGAGCCAGG - Intergenic
1045013792 8:97981436-97981458 CTGTGCATATACCACGTGCCTGG + Intronic
1045752227 8:105498597-105498619 CTGTGCTAAGAGCAGATGCTTGG - Intronic
1047203589 8:122785807-122785829 CTGTGCAAAGAGATGATGCCAGG + Intronic
1048967106 8:139623381-139623403 CTGTGCCAAGAGCAGGTCCCAGG - Intronic
1049322615 8:142004885-142004907 CTGGGCCTGGAGCAGGTGCCCGG - Intergenic
1049397515 8:142408164-142408186 CTGTGGAATGAGGAGGAGCCAGG - Intergenic
1049519649 8:143081339-143081361 CCGGGCAGAGGGCAGGTGCCAGG + Intronic
1049641608 8:143718509-143718531 CTGTGGTCAGAGCAGGAGCCTGG - Intronic
1052255906 9:26456226-26456248 TTGTGGAAAGGGCATGTGCCTGG + Intergenic
1055510700 9:76993237-76993259 CTCTGCAGAGAGAGGGTGCCTGG + Intergenic
1056063263 9:82906925-82906947 GTGTCCAAAGAGCAGCTGACTGG + Intergenic
1056690805 9:88807271-88807293 CTGTCCAAAGAGCAGACCCCAGG - Intergenic
1057304564 9:93904723-93904745 CTGTGCACAGTGCAAGTGCTGGG + Intergenic
1057438794 9:95066600-95066622 CTGTGCAAACAGCAGACGGCAGG - Intronic
1057845082 9:98516733-98516755 CTTGGCACAGAGCAGTTGCCTGG + Intronic
1059708419 9:116845085-116845107 CAGTGGAGAGAGCAGGGGCCTGG - Intronic
1060052434 9:120386903-120386925 CTGTGCACTGACCATGTGCCAGG + Intergenic
1061618463 9:131795206-131795228 CTGAGGAAATAGCAGGTGCAAGG - Intergenic
1061655622 9:132087759-132087781 GAGTGCAAAGGGCAGATGCCTGG + Intergenic
1061678660 9:132231883-132231905 CTGGGCAGAGAGCAGGGGCTTGG + Intronic
1061852437 9:133424017-133424039 CTGTGCCCAGAGCAGGGTCCAGG + Intronic
1062395591 9:136351368-136351390 CTGTGGACAGGGCAGGTGTCTGG - Intronic
1062614254 9:137388887-137388909 CTGTGCTGATAGCAGGTGCCTGG - Intronic
1203430953 Un_GL000195v1:90945-90967 ATGTGAAAAGAGCTGGTTCCCGG + Intergenic
1203435557 Un_GL000195v1:133682-133704 ATGTGAAAAGAGCTGGTTCCCGG - Intergenic
1203521866 Un_GL000213v1:53097-53119 CTGAGCACAGTGCAGGTGCTGGG - Intergenic
1189220730 X:39369442-39369464 CTGTGCAAGAGGGAGGTGCCAGG - Intergenic
1193551098 X:82893599-82893621 CTGTGCAGAGATCTGGTGCAGGG + Intergenic
1197026356 X:121754557-121754579 CTTTGCAAAGAACAGGAGGCAGG + Intergenic
1202411958 Y:24583465-24583487 TTGTGCAAGGAGGAGGAGCCTGG - Intergenic