ID: 967887508

View in Genome Browser
Species Human (GRCh38)
Location 3:194343081-194343103
Sequence CTCTTTGCACAGTTGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 193}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967887500_967887508 28 Left 967887500 3:194343030-194343052 CCAAATCTCAGCACACGTCAGAG 0: 1
1: 0
2: 1
3: 5
4: 107
Right 967887508 3:194343081-194343103 CTCTTTGCACAGTTGGTGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 193
967887502_967887508 5 Left 967887502 3:194343053-194343075 CCAAATGATGCAGAGATCCTGGC 0: 1
1: 0
2: 1
3: 8
4: 121
Right 967887508 3:194343081-194343103 CTCTTTGCACAGTTGGTGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967887508 Original CRISPR CTCTTTGCACAGTTGGTGGA GGG Intronic
900694594 1:4002037-4002059 CTGTTTGGACAGGTGGTGGGGGG - Intergenic
900823343 1:4907201-4907223 CTCTGTGCTCACATGGTGGAAGG + Intergenic
900918425 1:5654848-5654870 GTCTTTGCACATCTGGTGGGTGG - Intergenic
901460295 1:9387243-9387265 CTTTGTGCACTGTTGGTGTAAGG - Intergenic
902060103 1:13634830-13634852 ATCTTTGCACAGGGGGTTGAAGG - Intergenic
903049454 1:20589799-20589821 CACTGAGCACAGTGGGTGGAAGG - Intronic
904895927 1:33818220-33818242 CTCTCTGCACAGCTGGTGTCTGG + Intronic
905620018 1:39437029-39437051 CCATTTACACAGCTGGTGGAGGG + Intronic
905694904 1:39967074-39967096 CTCCATGCCCAGCTGGTGGAGGG + Exonic
905759439 1:40541892-40541914 CTCTTTGCTCAGCTGTTGTATGG + Intronic
906678816 1:47711251-47711273 CTCTTAGGACTGTTGGGGGAGGG + Intergenic
909549516 1:76882159-76882181 CCATTTGCAAAGTTGGTGGTTGG - Intronic
910426115 1:87121284-87121306 GTCTTTGCACAGTGAGTGGCAGG - Intronic
914448671 1:147771940-147771962 CTCTGGGGACAGTGGGTGGAGGG + Intronic
914692325 1:150041809-150041831 CTCTTTTAAAAGTTGGGGGATGG - Intergenic
916196653 1:162230124-162230146 CTCCTTGCAGAGTTAGTGGCTGG + Intronic
917574608 1:176308041-176308063 CTCTTTGCACATTAGGTAGGAGG + Intergenic
920563835 1:206958410-206958432 CTCTTCCCACAGGTGGAGGAAGG + Exonic
922558088 1:226548545-226548567 CTGTTTGCCCAGGTGCTGGAAGG - Intergenic
922990886 1:229910164-229910186 CTGTTTCCACACATGGTGGAAGG - Intergenic
922998542 1:229986162-229986184 ATCTTTGCACAGTTGCTTGAAGG - Intergenic
923566427 1:235079885-235079907 CTCTTGGCAGAGTTACTGGAAGG - Intergenic
923731199 1:236551998-236552020 TTCTTAGCAGAGTTGATGGAAGG - Exonic
1064185796 10:13161137-13161159 CTCACTGCACAGATGGTGAAGGG + Intergenic
1067534793 10:47101188-47101210 CACTCTGCACAGTATGTGGATGG + Intergenic
1069357268 10:67601263-67601285 ATTTTTCCACAGATGGTGGATGG + Intronic
1071513742 10:86283284-86283306 CTATTTGCACAGGTTGGGGAGGG + Intronic
1071616044 10:87077510-87077532 CTCTTTGCAGAAGTGGTGAAGGG - Intronic
1075888271 10:125921889-125921911 TTCTTTGCAGGGGTGGTGGAAGG - Intronic
1075968511 10:126633194-126633216 GTCTTTGGGCAGTTGATGGAGGG - Intronic
1076223491 10:128754416-128754438 CTCTCTCCTCAGTTGGTGGATGG - Intergenic
1077573503 11:3358182-3358204 CTGTCTGCACAGTTACTGGAGGG + Intronic
1079465077 11:20722394-20722416 CTCTTTACACAGTAGTTGTATGG + Intronic
1079860194 11:25659749-25659771 CACTGTCCTCAGTTGGTGGATGG - Intergenic
1079983549 11:27177258-27177280 CCCTTGTTACAGTTGGTGGAGGG + Intergenic
1082093690 11:48109718-48109740 CTCATCGCACAGTGGGTGGAGGG + Intronic
1082771427 11:57210796-57210818 CTGTCTGCACCGTTGGAGGATGG - Intergenic
1083894725 11:65614132-65614154 CTTTTTGCGCAGGGGGTGGAGGG + Exonic
1083939135 11:65885811-65885833 CTCTTCGCACAGATGGGGAAGGG - Intronic
1084357726 11:68651096-68651118 CACTGTGCTCACTTGGTGGATGG - Intergenic
1085856415 11:80181298-80181320 CTCTTTGCAGTGTTAGTGCAAGG + Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091722151 12:2821241-2821263 CCCTGTGCACAGCAGGTGGACGG - Exonic
1091750836 12:3020479-3020501 CTCCTAGCAGAGGTGGTGGAGGG - Intronic
1092148620 12:6232076-6232098 CTCTTTGCCCTGTTGCTGGGTGG - Intronic
1092820707 12:12350717-12350739 CTCTTTCCATAATTGGAGGATGG + Intergenic
1096985254 12:55751891-55751913 CCCCTTGGCCAGTTGGTGGAAGG + Exonic
1098171082 12:67747954-67747976 CACATTGGACACTTGGTGGAAGG - Intergenic
1100193110 12:92214135-92214157 CGCCTTGCACATTTGGAGGAAGG + Intergenic
1100490032 12:95070444-95070466 CTTTATACACTGTTGGTGGAAGG + Intronic
1102255185 12:111410879-111410901 CTCTATGAACAGTTGGTGCTAGG + Intronic
1102514037 12:113434717-113434739 CTCTTTGCAAAGTTGGGGAGGGG + Intronic
1102799997 12:115723801-115723823 TTCTTGTCACATTTGGTGGATGG - Intergenic
1103953826 12:124566147-124566169 CTTTTTGCAGATTTGGAGGAAGG - Intronic
1104304327 12:127595601-127595623 CTCTTTGAAATGTTTGTGGATGG + Intergenic
1104947967 12:132425476-132425498 CTCGGTGCACAGTGGGTGGCAGG + Intergenic
1106722409 13:32448998-32449020 CTCCTTGCAAAGTTGTTGTAAGG + Intronic
1107300799 13:38963881-38963903 CTGTGTCCTCAGTTGGTGGAAGG - Intergenic
1112780492 13:102895503-102895525 TTCTTTGCACAGATGGTCAAAGG - Intergenic
1119613106 14:76080355-76080377 CTTTGTGCACATTTGGAGGAGGG + Intronic
1122768026 14:104085130-104085152 CTCTGTGCTCAGGTCGTGGAGGG + Intergenic
1202828285 14_GL000009v2_random:389-411 CTTTTTGAACAGTTGTTGTATGG + Intergenic
1202904775 14_GL000194v1_random:62734-62756 CTCATTGCACAATAGGTTGAGGG + Intergenic
1125311839 15:38388166-38388188 CCCTTTGCATAATTGGTAGATGG + Intergenic
1125513625 15:40306201-40306223 CTTTTGGCACAGTTAGTGGATGG - Intronic
1127558864 15:60115752-60115774 CTCTTTCCCCAGTTGATGAACGG + Intergenic
1127822313 15:62669522-62669544 CTCAATGCACAGTTTGTAGATGG + Intronic
1131335338 15:91543704-91543726 CTCTGCGCACAGGTGGTGAATGG + Intergenic
1135914080 16:26588249-26588271 ATTTATGCACACTTGGTGGAAGG - Intergenic
1148744579 17:49911267-49911289 CTGTTTGCCCAGTTGCTGGGTGG + Intergenic
1149408316 17:56377753-56377775 CTCCTTGCAGGGTTGGGGGATGG + Intronic
1150475927 17:65474955-65474977 CTCTCAGCAGAGTTGGTAGATGG + Intergenic
1151220189 17:72606212-72606234 CTCTTCCCACAGTCAGTGGAGGG - Intergenic
1153661401 18:7329355-7329377 CTCTTTGCAAGCTTGGAGGAGGG - Intergenic
1153679381 18:7485717-7485739 CTCTGTTCAAAGTGGGTGGAGGG - Intergenic
1156305265 18:35873345-35873367 CTGATGGCACAGTTGGAGGAGGG - Intergenic
1159510446 18:69391817-69391839 CTCTCTCCACAGCTGGTAGATGG + Intergenic
1161973782 19:7597611-7597633 CTCTTTGCAAGGTTGCTGGGAGG + Intronic
1166641390 19:44497932-44497954 CTCTGTGCTGAGTTGCTGGAGGG - Intronic
1167812776 19:51849115-51849137 CTATTTCCACAGTTTGGGGAAGG + Intergenic
1168373392 19:55855328-55855350 CTCTTTTCACAGTTGGTTTGAGG + Intronic
1202644414 1_KI270706v1_random:127431-127453 CTTTTTGAACAGTTGTTGTATGG - Intergenic
926626678 2:15096279-15096301 CTCTTTGACCAGTTGGTAAATGG - Intergenic
927208438 2:20624419-20624441 CTCTGTGCAGAGTTGGCAGAGGG - Intronic
930376882 2:50579119-50579141 CTCTACCCACAGTTTGTGGATGG - Intronic
932027113 2:68145393-68145415 ACCTTTGCATATTTGGTGGATGG - Intronic
935572028 2:104671679-104671701 ACATTTGCACAGTTGGTGAATGG - Intergenic
935708247 2:105875068-105875090 GTCATGGCACAGTTGGTGGCTGG + Intronic
940828966 2:158446371-158446393 ATCTTTGCATAATTGGTGGATGG - Intronic
941706105 2:168659726-168659748 CTCTTTGCAAAGTTGGATGGTGG + Intronic
942262525 2:174183305-174183327 ATCATTGCACAGCTGGTGGCTGG - Intronic
944525299 2:200612747-200612769 TTCTTGGCACAGATGGTGGCTGG - Exonic
945726498 2:213476760-213476782 CTCTTAGCTCAGGTAGTGGAAGG + Intronic
945933450 2:215879804-215879826 ATTTTTCCACAGATGGTGGAGGG + Intergenic
946096247 2:217276863-217276885 CTCTTTGCACACTCTTTGGAAGG + Intergenic
947723789 2:232384572-232384594 ACCTTTGCATATTTGGTGGATGG - Intergenic
947925107 2:233914438-233914460 CCCTTTGCACAATGGGAGGAAGG + Intergenic
948120710 2:235528323-235528345 CTGAGTGCACAGATGGTGGATGG - Intronic
948324373 2:237101214-237101236 CTCTTTGCAGGGTCGGTGGCAGG + Intergenic
1169754297 20:9026811-9026833 CTGTTTCCACTCTTGGTGGAAGG + Intergenic
1172189441 20:33053415-33053437 CTCTGGGCACACTTGGGGGAGGG - Intergenic
1175515668 20:59568384-59568406 CTCTGTGCCCAGGTGGAGGAGGG + Intergenic
1175839999 20:62020606-62020628 CTGTTTGCCCATCTGGTGGAGGG - Intronic
1176185448 20:63775881-63775903 CTCTATGCACAGGTGGAGGAGGG - Exonic
1176607467 21:8845223-8845245 CTTTTTGAACAGTTGTTGTATGG + Intergenic
1176624143 21:9077499-9077521 CTCATTGCACAATAGGTTGAGGG + Intergenic
1179109865 21:38437321-38437343 CTCTTTGGACAGGTGGGGGTGGG + Intronic
1180357550 22:11855010-11855032 CTTTTTGAACAGTTGTTGTATGG + Intergenic
1180380714 22:12137323-12137345 CTTTTTGAACAGTTGTTGTATGG - Intergenic
1181689030 22:24548133-24548155 CTCTTGGGCCAGTGGGTGGAGGG - Intronic
1182579366 22:31295491-31295513 CTCTTTGCACAATTTTTGGTGGG + Intergenic
1183342481 22:37289322-37289344 CTCTTTCCACAGGAAGTGGATGG + Intronic
1183586705 22:38756910-38756932 CTATCTGTACAGTTGGCGGATGG - Intronic
1185187918 22:49413939-49413961 CTCTCTCCTCAGCTGGTGGACGG + Intergenic
951374580 3:21897719-21897741 CTAGTTGCACAGTGGGTGTATGG + Intronic
953196138 3:40735406-40735428 CTCTTGCCACAGTGGGTTGAGGG - Intergenic
957297503 3:78352016-78352038 CTCTTTTTACAGTTGGGGGTGGG - Intergenic
959304494 3:104643628-104643650 ATCTTTGAATAGTTGTTGGAGGG + Intergenic
959483115 3:106897440-106897462 CTTTTTGAACAGTTGATGTATGG + Intergenic
961296145 3:125886236-125886258 CTCCTTGCAGAGTTGGCAGATGG - Intergenic
962128487 3:132647907-132647929 CTCTTTCCTCACATGGTGGAAGG + Intronic
962426801 3:135277409-135277431 CTCTCTGCACATTTTGTGGTGGG - Intergenic
965022670 3:163253633-163253655 CTCTATACACAGTAGGTTGAGGG - Intergenic
966885799 3:184377559-184377581 CTCTTTGCACAACTTGTGAAAGG - Intronic
967887508 3:194343081-194343103 CTCTTTGCACAGTTGGTGGAGGG + Intronic
973328948 4:48893075-48893097 AACTTTGCACTGGTGGTGGAAGG + Intronic
973695643 4:53487957-53487979 ATATTTGAACAGTTGCTGGAAGG - Intronic
976058039 4:81092388-81092410 CTCTTTGCAAAGGTGATGGAAGG + Exonic
980372086 4:131888303-131888325 CTCTTTGCAAAGCTGTTGAAGGG + Intergenic
981169734 4:141607105-141607127 CTTTATGCACAGTTGATTGATGG + Intergenic
985385088 4:189437099-189437121 CTCTTTTCAAACTTAGTGGATGG - Intergenic
985819869 5:2152331-2152353 CTCATTGCACAGATGGAAGATGG + Intergenic
985819872 5:2152366-2152388 CTCATTGCACAGATGGAAGATGG + Intergenic
985819875 5:2152401-2152423 CTCATTGCACAGATGGAAGATGG + Intergenic
986083640 5:4420471-4420493 CTCTGTGCAGAGTAGCTGGATGG - Intergenic
986570576 5:9160378-9160400 CTCTTTAAACAGTTGGTTTAAGG - Intronic
990738147 5:58886763-58886785 CTCTTTCGAAATTTGGTGGATGG + Intergenic
993483760 5:88456180-88456202 CTGTTTGCACAGTTGTTAAATGG + Intergenic
993956509 5:94241055-94241077 CTCTTTGCACAGATGGCTGGTGG + Intronic
996890823 5:128417524-128417546 TTCTATGCATAGTTTGTGGAGGG + Intronic
998426958 5:142036970-142036992 CTCCTTGCAAAATTGGTTGATGG + Intergenic
1000640250 5:163693779-163693801 CTTTTTACACTGTTGGTGGGAGG + Intergenic
1000865961 5:166515023-166515045 GTCTTTGTACAGTTGTTTGAAGG - Intergenic
1002889977 6:1324012-1324034 CTCTGTGCCCAGCTGGAGGATGG + Intergenic
1003508461 6:6759411-6759433 CGCTTTGCACAGGGGCTGGAAGG - Intergenic
1003859605 6:10310252-10310274 CTCATTACACAGTTGTTGGAAGG - Intergenic
1008099966 6:47379870-47379892 CTCTTTTCAAAGTTGGTGATCGG - Intergenic
1008167906 6:48163368-48163390 TTCTTTGCAAAGAGGGTGGAAGG - Intergenic
1008428684 6:51389134-51389156 ACCTTTGCACAGTTGGGGCATGG + Intergenic
1009974324 6:70657043-70657065 TTGCTTGCTCAGTTGGTGGAAGG + Intergenic
1012064629 6:94534808-94534830 CTCTTTTCACAATTGATAGATGG + Intergenic
1012453665 6:99381006-99381028 CACCTTGCAGAGTTGTTGGAAGG - Intronic
1013440865 6:110166736-110166758 TTCTTTGCACAGTTTGTAAATGG - Intronic
1013796915 6:113898550-113898572 CTCTCTTCAGAGTTGGAGGATGG + Intergenic
1014145319 6:117990956-117990978 CTTTTTTCATATTTGGTGGATGG - Intronic
1015811159 6:137163517-137163539 CCATTTGCACTGTTGGAGGAAGG - Intronic
1016127119 6:140417524-140417546 CCCTGTGCACAGTTGGTTGAAGG - Intergenic
1021071561 7:16248370-16248392 GTCTTTGTGCATTTGGTGGAGGG + Intronic
1021443046 7:20701080-20701102 CTTTTTGCACAGAAGGTGTAAGG - Intronic
1021505919 7:21384970-21384992 AACTTTGCAGAGTTGGGGGAGGG + Intergenic
1022335217 7:29415572-29415594 CTCGGGACACAGTTGGTGGAGGG + Intronic
1022521384 7:31009574-31009596 CTCTCTGCACATTTGATTGATGG + Intergenic
1023800422 7:43829126-43829148 CTCTTTGCACACTTGGATCAGGG + Intergenic
1024034758 7:45497769-45497791 CCCTTTGTACAGTTGGTGATGGG + Intergenic
1025229420 7:57191350-57191372 CTTTTTGGACAGTTGTTGTATGG - Intergenic
1027533108 7:79360687-79360709 CTCTTTGCATAGTTTTTGGGTGG - Intronic
1027963088 7:84971766-84971788 CTCTTTGCTAAGTTTGAGGAGGG - Intergenic
1028549729 7:92046620-92046642 CTCTTTTCAAACTTGGTGGAAGG + Intronic
1030099883 7:105936430-105936452 CTCTGTGCTCACATGGTGGAAGG - Intronic
1031218577 7:118931458-118931480 CTCCTTCCACAATTCGTGGAAGG - Intergenic
1032709050 7:134446733-134446755 CTCCTTGCAGAGCTGGTGAATGG + Intronic
1034604577 7:152300257-152300279 CTGTTTGCACAGTTGGTCCTAGG + Intronic
1037105955 8:15108509-15108531 CTCTTAGCACAGTTGTTCAATGG - Intronic
1038358614 8:26854932-26854954 CTGTGTGCTCACTTGGTGGAAGG - Intronic
1038620138 8:29134861-29134883 CTCTATGCAGATTTGGGGGAAGG + Intronic
1039222963 8:35355830-35355852 CTGTTTTCTCACTTGGTGGAAGG - Intronic
1039944579 8:42118433-42118455 CTCTTTCCACACTTGGTGGTCGG - Intergenic
1040818366 8:51532342-51532364 ATTGTTGCACAGTTGGTGAACGG - Intronic
1040918822 8:52593363-52593385 ATCTTTGCACAGTTGGTGATAGG - Intergenic
1043172580 8:76983837-76983859 CTGTTTGTACAATTGGTGGCAGG - Exonic
1043219071 8:77635985-77636007 ATCTTTGCACAGTGGTTGGATGG + Intergenic
1046190159 8:110784768-110784790 CTCTTTGCTATGTTAGTGGAAGG + Intergenic
1047988754 8:130263788-130263810 CTCTGTGCATAGTTGGTAGAAGG - Intronic
1048564665 8:135582853-135582875 CTCTTTGCATAGTTTCTAGAAGG + Intronic
1048583441 8:135750138-135750160 ATTTTTCCACAGATGGTGGAAGG - Intergenic
1053447474 9:38164178-38164200 CCCTTTGCACAGTGAGGGGAGGG - Intergenic
1053636790 9:40015860-40015882 CTCTTTGCAAAGCTGTTGAAGGG + Intergenic
1053769199 9:41448754-41448776 CTCTTTGCAAAGCTGTTGAAGGG - Intergenic
1054317659 9:63612941-63612963 CTCTTTGCAAAGCTGTTGAAGGG + Intergenic
1054354272 9:64046410-64046432 CTTTTTGAACAGTTGTTGTATGG + Intergenic
1054547870 9:66360255-66360277 CTCTTTGCAAAGCTGTTGAAGGG - Intergenic
1055467918 9:76583623-76583645 CTCTTGGCCCATTGGGTGGATGG + Intergenic
1055968250 9:81886367-81886389 CTCTTTCCACAAATGGTGGTGGG - Intergenic
1060559775 9:124533482-124533504 CCCTTTGCACAGCTAGGGGAGGG - Intronic
1062246265 9:135568117-135568139 CTCATTGCCCAGCTGGTGGGTGG + Intergenic
1203747326 Un_GL000218v1:47927-47949 CTCATTGCACAATAGGTTGAGGG + Intergenic
1203702801 Un_KI270742v1:10111-10133 CTTTTTGAACAGTTGTTGTATGG + Intergenic
1203562410 Un_KI270744v1:69874-69896 CTCATTGCACAATAGGTTGAGGG - Intergenic
1203567494 Un_KI270744v1:103896-103918 CTTTTTGAACAGTTGTTGTATGG - Intergenic
1187483494 X:19679938-19679960 ATCTATTCACAGTTGGTGGAGGG + Intronic
1189877226 X:45448614-45448636 CTCTTTGCTCCATTGGGGGAGGG - Intergenic
1191221656 X:57995298-57995320 CTTTTTACACTGTTGGTGGGAGG - Intergenic
1192596573 X:72414684-72414706 CTCTCTGCACAGTTAGGGGTGGG - Intronic
1193555493 X:82948932-82948954 CTCTTTGCAGAGATTGTGAATGG - Intergenic
1194057277 X:89151320-89151342 CTCTGTGCCCAGGTGGTGTATGG + Intergenic
1194492453 X:94568519-94568541 CTCTTTGTACTGCTGGGGGATGG + Intergenic
1196941014 X:120775843-120775865 CTCTTTCCTCATATGGTGGAAGG - Intergenic
1201160647 Y:11162922-11162944 CTCATTGCACAATAGGTTGAGGG + Intergenic
1201274959 Y:12287998-12288020 CTGTCTGCACAGTTACTGGAAGG + Intergenic