ID: 967891186

View in Genome Browser
Species Human (GRCh38)
Location 3:194365692-194365714
Sequence GGACCTGCTGGACCTCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 270}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967891179_967891186 7 Left 967891179 3:194365662-194365684 CCTCATTCTCCTCATCTTCTCTT 0: 1
1: 0
2: 6
3: 125
4: 1446
Right 967891186 3:194365692-194365714 GGACCTGCTGGACCTCCAGCAGG 0: 1
1: 0
2: 1
3: 26
4: 270
967891178_967891186 8 Left 967891178 3:194365661-194365683 CCCTCATTCTCCTCATCTTCTCT 0: 1
1: 1
2: 7
3: 119
4: 1183
Right 967891186 3:194365692-194365714 GGACCTGCTGGACCTCCAGCAGG 0: 1
1: 0
2: 1
3: 26
4: 270
967891177_967891186 9 Left 967891177 3:194365660-194365682 CCCCTCATTCTCCTCATCTTCTC 0: 1
1: 0
2: 9
3: 96
4: 970
Right 967891186 3:194365692-194365714 GGACCTGCTGGACCTCCAGCAGG 0: 1
1: 0
2: 1
3: 26
4: 270
967891180_967891186 -2 Left 967891180 3:194365671-194365693 CCTCATCTTCTCTTCCCCAGAGG 0: 1
1: 0
2: 5
3: 61
4: 442
Right 967891186 3:194365692-194365714 GGACCTGCTGGACCTCCAGCAGG 0: 1
1: 0
2: 1
3: 26
4: 270
967891176_967891186 16 Left 967891176 3:194365653-194365675 CCTGAAGCCCCTCATTCTCCTCA 0: 1
1: 0
2: 1
3: 28
4: 334
Right 967891186 3:194365692-194365714 GGACCTGCTGGACCTCCAGCAGG 0: 1
1: 0
2: 1
3: 26
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967891186 Original CRISPR GGACCTGCTGGACCTCCAGC AGG Intronic
900098864 1:952492-952514 GGAGCTGCTGGCCCTGGAGCCGG - Exonic
900638993 1:3679351-3679373 GGAACCCCTGGACCTCCAGTAGG + Intronic
900651656 1:3732797-3732819 GGGCCTGCAGGACCTGAAGCAGG + Exonic
900660672 1:3781180-3781202 GGACCTGCTCCACCACCAGAAGG + Exonic
900720234 1:4171287-4171309 GGAGCTGCAGGACGTCCAGTGGG - Intergenic
901490867 1:9595595-9595617 GGATCTGCTGAGGCTCCAGCTGG + Intronic
901635026 1:10666510-10666532 GCACCTGCTGGAGCTCCTGGGGG - Intronic
902618653 1:17637922-17637944 GGAGCTGCAGGACCTGCAGAAGG + Exonic
903287858 1:22288187-22288209 GGACCCACTGGACTTCCCGCAGG + Intergenic
903345906 1:22684258-22684280 GGCCCTGCTGCGGCTCCAGCTGG - Intergenic
903791370 1:25895481-25895503 GCAAATGCTGGGCCTCCAGCAGG + Intronic
904261726 1:29291450-29291472 GGACATGCTGGGCCTGGAGCTGG + Intronic
904351182 1:29907818-29907840 GGACAGGCTCGACCTCGAGCAGG - Intergenic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
904743346 1:32695455-32695477 GGACTTGCTGTACCTCCTGCAGG + Exonic
906063510 1:42963348-42963370 GGACCTGTGGGACATCCAGAGGG - Intergenic
906674006 1:47680052-47680074 GGAGCTGCTGGCCCTCCATGAGG - Intergenic
910059409 1:83070497-83070519 AGACCTGCTGGACAACCAACTGG + Intergenic
910599130 1:89011827-89011849 GGAGCTGCTGGACCTGCACAGGG - Exonic
910603499 1:89056934-89056956 GGAGCTGCTGGACCTGCACAGGG - Exonic
910608513 1:89114096-89114118 GGAGCTGCTGGACCTGCACAGGG - Exonic
910637219 1:89422182-89422204 GGAGCTGCTGGACCTGCACAGGG + Intergenic
914918403 1:151831861-151831883 GGAGCACCTGGCCCTCCAGCAGG + Exonic
914928034 1:151906178-151906200 GGACCAGCTGGAGTTCCAGGTGG + Intronic
915191540 1:154154852-154154874 AGCCCCGCTGGGCCTCCAGCAGG + Exonic
915472821 1:156136044-156136066 GGAGCTTCTGGACATCAAGCTGG + Exonic
915559173 1:156676580-156676602 GGAGCTGCTGCAGCTCCAGGCGG + Exonic
919945273 1:202314809-202314831 GGACCTGGATGAGCTCCAGCTGG + Exonic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
920252918 1:204633965-204633987 GGAGCCGCTGGTCCTGCAGCAGG - Intronic
922707581 1:227797356-227797378 GGACCACCTGCAGCTCCAGCTGG + Intergenic
922785186 1:228279113-228279135 GGACATGCTGCCCCTCCGGCAGG - Intronic
923626397 1:235617164-235617186 GGGCATCCTGGACCTCCGGCTGG + Intronic
924230485 1:241958258-241958280 GGAGCTGCGGGACCTGGAGCTGG + Intergenic
1064007165 10:11707915-11707937 GGTCCCCCTGGCCCTCCAGCAGG - Intergenic
1065239182 10:23687853-23687875 GGTGCTCCTGGACCTCCAGAAGG - Intergenic
1066048991 10:31618269-31618291 GGTCATGCTGGGCTTCCAGCAGG + Intergenic
1067694197 10:48523714-48523736 GGACTTGGCGGACCTGCAGCCGG + Intronic
1068385867 10:56326825-56326847 CGACCTGCTGAACTTCCAGATGG - Intergenic
1069949218 10:72007907-72007929 GGACCTGCGCGTCATCCAGCTGG + Exonic
1071717814 10:88114705-88114727 GGACCTGCAGGACCTGCCCCTGG + Intergenic
1073123042 10:101133505-101133527 GGCCCTGCTGGAAACCCAGCCGG + Intronic
1073285478 10:102385023-102385045 GGCCCTGTTGTACTTCCAGCTGG + Intergenic
1073432283 10:103494258-103494280 GGCCCTGCTGGGGCTGCAGCCGG - Exonic
1074015341 10:109528724-109528746 GGGCCTGCTGGGCCTCCTGCTGG - Intergenic
1074554528 10:114476183-114476205 GCACCTGGTGCACCTCCACCTGG - Intronic
1074782879 10:116814707-116814729 GGACCTGCTGAATCACCACCAGG + Intergenic
1074983754 10:118639950-118639972 GAACGTGCAGGACCTGCAGCTGG + Intergenic
1075688028 10:124377479-124377501 GCAGGTGCTGGACCTGCAGCCGG - Intergenic
1076875058 10:133211705-133211727 GCACCTGCTGGGCCTCCTGGAGG + Exonic
1077018687 11:407895-407917 GGTCCTGCTGGCCCTGCTGCTGG - Exonic
1077154002 11:1083486-1083508 GGGCCAGCTGCACCTGCAGCCGG - Intergenic
1077205242 11:1338870-1338892 GGAGCTGCCCGGCCTCCAGCAGG + Intergenic
1077431326 11:2517314-2517336 GCACCTGATGGACCTCCAGGTGG + Intronic
1077903604 11:6511330-6511352 TGAGCTGCTGGACCTGCAGACGG + Exonic
1080107521 11:28526102-28526124 GGGCCAGCTGGAGCTCCAGATGG - Intergenic
1081572925 11:44302723-44302745 GGCCCTGTAGGACCTCTAGCCGG + Intronic
1083477374 11:62923029-62923051 GTGCCTGCTGGAACCCCAGCTGG - Intergenic
1083746028 11:64736899-64736921 GGACCTGGTGGCCCTGCAGCTGG - Exonic
1083779367 11:64910047-64910069 GTACCTGCTGAGCCTCCAGCCGG - Exonic
1084273999 11:68042722-68042744 GGACCTGCTGCGCATCCAGGAGG + Exonic
1084489844 11:69472231-69472253 GGACCTGCTGCATCTGCTGCAGG + Intergenic
1084541747 11:69791259-69791281 GCATCTGGTGGACCTACAGCCGG + Intergenic
1085043298 11:73339531-73339553 GGGCCACCTGGTCCTCCAGCTGG - Intronic
1086729833 11:90235270-90235292 GTACCAGCTGGAACTCCAGGTGG + Intergenic
1088946027 11:114513192-114513214 GCACCAGCTGGACATCCTGCTGG - Intergenic
1090473895 11:127003252-127003274 GTACCTGCAGGACCCACAGCCGG + Intronic
1092042024 12:5393577-5393599 GGAACCTCTGGACCACCAGCTGG + Intergenic
1092264034 12:6967756-6967778 GGGCCCGCTGGGCCTCCTGCTGG + Exonic
1092284642 12:7121720-7121742 GGACCATCTGGAGTTCCAGCTGG + Intergenic
1092956321 12:13553585-13553607 GGTCCTGTTGGACCACCACCTGG + Exonic
1093181523 12:15972423-15972445 GGCCCTGCGGGACAGCCAGCTGG - Intronic
1094470206 12:30795933-30795955 GGTCCTGCGGGACAGCCAGCAGG - Intergenic
1096260376 12:50086295-50086317 GGACCTGCTGGATCTGCTGAGGG - Exonic
1096670924 12:53197828-53197850 GGTCCTGCAGCACCTCCTGCTGG + Exonic
1097035583 12:56121562-56121584 GGAGCAGCTGGAGCTCCAGCAGG - Exonic
1098764512 12:74469188-74469210 GGAGGTGCTGGACTTCCTGCAGG + Intergenic
1100702967 12:97167425-97167447 GGAACTGCTGGACCCCCTGGGGG + Intergenic
1101445505 12:104734346-104734368 GGAACTGCTGGTCCTTCAGGAGG - Intronic
1101605844 12:106247440-106247462 GGACCTGCTGGACCTCCTCCAGG + Exonic
1101879383 12:108616225-108616247 GGGCCTGCTCAACCTCCAGGTGG - Intergenic
1103317875 12:120071633-120071655 GCACCTCCTGAAGCTCCAGCTGG - Exonic
1103760043 12:123242641-123242663 AGACCTTCTTGAACTCCAGCTGG + Intronic
1104036782 12:125103116-125103138 GGACCCACTGGAGCTCCTGCGGG + Intronic
1105281370 13:18964625-18964647 AGACCTGCTGGAGCTGGAGCTGG - Intergenic
1105817596 13:24051278-24051300 GGACATGCTGTGCCTGCAGCCGG + Intronic
1112051762 13:95649831-95649853 GGGCCTGCTTGAGCTACAGCTGG + Intergenic
1112157629 13:96834831-96834853 GGAGCTGCTGGACTTCCCTCGGG - Exonic
1115291433 14:31777297-31777319 GGACCAGATGGACCTGGAGCAGG - Intronic
1115490077 14:33950569-33950591 GGCCCTGCGGGACGGCCAGCTGG - Exonic
1116023362 14:39487289-39487311 GGACAGGATGGACCTGCAGCAGG - Intergenic
1118652091 14:67907565-67907587 GTACCTGCTGGGGGTCCAGCTGG + Intronic
1118652092 14:67907568-67907590 GTTCCAGCTGGACCCCCAGCAGG - Intronic
1120445986 14:84597129-84597151 GGATCTGCTGGACCAGCTGCAGG + Intergenic
1120778412 14:88463119-88463141 GGAACTGCTGCTCCTTCAGCTGG + Intronic
1121004821 14:90483504-90483526 GCACCTGCTGGGCCTCCTGTTGG + Intergenic
1121111053 14:91313391-91313413 GGACCTGGAGGCCCTCCGGCTGG - Exonic
1122023131 14:98855867-98855889 GGGGCTGCTGGAGCCCCAGCAGG + Intergenic
1128781796 15:70363153-70363175 GCACCTCCTGGCCCACCAGCTGG + Intergenic
1131440504 15:92456089-92456111 GGTCTTGCTGGACCTCCTGCTGG + Intronic
1132200907 15:99954185-99954207 AGACCTCCTTGACCTCCAGAAGG - Intergenic
1132601492 16:775023-775045 CGACCTGCTGGCCCTGCAGGGGG - Exonic
1132607312 16:799005-799027 GTACCAGCTGGCCTTCCAGCGGG - Exonic
1132897390 16:2235542-2235564 TGACCGTCTGCACCTCCAGCTGG - Exonic
1133258260 16:4531971-4531993 GGCCCCGCTGGGCCTCTAGCAGG + Intronic
1133758383 16:8779344-8779366 GGACTGGCAGGACCTCCAGGGGG - Intronic
1135013142 16:18902057-18902079 GGATCAGCTTGACCTCCAGTGGG + Intronic
1136316610 16:29458166-29458188 AAACCTGCTGGACCCACAGCAGG - Exonic
1136330297 16:29571351-29571373 GGATCAGCTTGACCTCCAGTGGG + Intergenic
1136409670 16:30068972-30068994 GGACCTGCAGGCCCACCTGCTGG - Exonic
1136417672 16:30113591-30113613 GGACCTGCTGAGCCTGCCGCTGG + Exonic
1136431186 16:30197508-30197530 AAACCTGCTGGACCCACAGCAGG - Exonic
1136444926 16:30311074-30311096 GGATCAGCTTGACCTCCAGTGGG + Intergenic
1137002822 16:35246162-35246184 GGACCTGCTGCACCAACACCTGG + Intergenic
1137016723 16:35384382-35384404 GGACCTGCTGAACCAACACCTGG + Intergenic
1140474662 16:75233842-75233864 TCACCTGCTGCAACTCCAGCTGG + Exonic
1142717683 17:1755824-1755846 GGACCCCCTGCACCTCCAGCAGG - Intergenic
1143723381 17:8828901-8828923 GGATCTGCAGGGCCTCCGGCCGG - Exonic
1144706295 17:17370651-17370673 GGGCCTGCAAGACCTCCAGGTGG - Intergenic
1144810266 17:17994370-17994392 GCGCCTGCTCGTCCTCCAGCTGG - Exonic
1144937698 17:18913357-18913379 GGACCTGCTTGAGCTATAGCTGG + Intronic
1146492199 17:33291470-33291492 GGACCGCCTGGGCCACCAGCTGG - Exonic
1146981162 17:37163022-37163044 GGAACTGTTTGACCGCCAGCTGG - Intronic
1148437955 17:47696776-47696798 TGACCTTCTCCACCTCCAGCAGG - Exonic
1148859919 17:50599477-50599499 GGACCAGCAGGCGCTCCAGCCGG + Exonic
1150069616 17:62139909-62139931 GGCCGTGGTGGACCACCAGCAGG + Intergenic
1151310298 17:73288655-73288677 GGAGGTGCTGGACTTCCAGTGGG - Intronic
1151669684 17:75565194-75565216 GGTCCTGCTGGAGCTCCAGGAGG - Intronic
1151912584 17:77093667-77093689 GGACCTGCCCGAGGTCCAGCAGG - Intronic
1152095341 17:78268981-78269003 GGACCTCCTGGGCCTCCGCCTGG + Intergenic
1152423577 17:80206978-80207000 TGCCCTCCTGGACGTCCAGCTGG + Exonic
1152588038 17:81197714-81197736 GGACCAGCTGGACTCCCAGCAGG - Exonic
1152754231 17:82080438-82080460 GGCTCTGCTGGGCCTGCAGCTGG + Exonic
1153377333 18:4395506-4395528 AGACCTGCTGGGCATGCAGCTGG + Intronic
1153828159 18:8896310-8896332 GGAACAGCTGGAGCTCCACCGGG - Intergenic
1157747212 18:50146417-50146439 GAAGCTGCTGGCACTCCAGCGGG - Intronic
1158017203 18:52797974-52797996 GGACCTGTTAGACCTCCATATGG + Intronic
1158409257 18:57190177-57190199 GGTCAGGCTGGACCTCCAGATGG + Intergenic
1159076673 18:63688502-63688524 GGAGCTGGTGGACTTCCTGCAGG - Intronic
1161104001 19:2434350-2434372 GGAGCTGCTGGACGTGAAGCTGG - Exonic
1161156319 19:2733473-2733495 GGACCTTCTGGAGCTGCAGCCGG + Exonic
1161288997 19:3482953-3482975 GGAGGGGCTGGACCTGCAGCTGG - Intergenic
1161384320 19:3982911-3982933 CGCCCTGCTGGAGCTGCAGCTGG - Exonic
1161486473 19:4538512-4538534 AGACCTCCAGGACCTCCAGCTGG + Exonic
1161515451 19:4693768-4693790 GGGCCTGCTGGGGCTCCAGGAGG - Intronic
1161641305 19:5425098-5425120 GTACCTGCTGGACCTCCAAGAGG - Intergenic
1161931838 19:7345765-7345787 CGCCCTGCAGGAGCTCCAGCTGG - Intergenic
1162096252 19:8311700-8311722 GGACCTGCAGGACAGACAGCAGG + Intronic
1162281311 19:9700219-9700241 GGACCGACTGAACCTGCAGCTGG + Intronic
1162387026 19:10365786-10365808 GTTCCTGCGGGACTTCCAGCCGG - Exonic
1162421206 19:10567081-10567103 GGACCTCGTGGACATCCTGCAGG - Exonic
1162514914 19:11142170-11142192 GCACCTGCTCGAGCTCCAGAGGG - Intronic
1162523581 19:11195282-11195304 GGACTTCCTGGGCCTCCACCCGG - Intronic
1162579839 19:11522381-11522403 GGAACTGCTTGACGGCCAGCCGG - Intronic
1164014188 19:21237553-21237575 AGATCAGCTGGACCACCAGCTGG + Intronic
1164063210 19:21693046-21693068 GGACCTGCTTGGCCTTCTGCAGG - Intergenic
1164120605 19:22261916-22261938 AGACTCGCTGGGCCTCCAGCAGG - Intergenic
1164158310 19:22609998-22610020 GCCCTTGCTGGACCACCAGCAGG - Intergenic
1165001158 19:32763661-32763683 GAACCTGCTAGAGCTCCAGGAGG + Intronic
1165104291 19:33459903-33459925 AGACCTGCTGGACTTTCTGCTGG - Intronic
1165120754 19:33556933-33556955 GGACCTGCCAGAGCTCCTGCTGG - Intergenic
1165153592 19:33774586-33774608 GGAACTGCTGGATCCCCAGATGG + Intergenic
1165762086 19:38327322-38327344 GGACATCCTGGGCCCCCAGCCGG + Exonic
1165800481 19:38546471-38546493 GGAGCTGCTGGATCTGCAGAAGG + Exonic
1166369688 19:42293916-42293938 GACCCTGCCGGCCCTCCAGCAGG + Exonic
1166852773 19:45768433-45768455 GGCCCTGGTGGCCTTCCAGCGGG - Exonic
1168723925 19:58570497-58570519 GGACCTCCTGGCCCTGCACCTGG + Exonic
929433610 2:41909552-41909574 GGATCTTCTGGACCTGCAGGAGG - Intergenic
929483058 2:42330168-42330190 GGTCTTGCTGGTCCTCCAGAAGG - Exonic
930691329 2:54368649-54368671 GCATCTGCTTGACCTCCAGAGGG + Intronic
931016086 2:57982367-57982389 GGACCTACTGCAGCTCCTGCCGG - Intronic
931246976 2:60499885-60499907 GAAGCTGCTAGACCTCAAGCAGG + Intronic
932594526 2:73085917-73085939 GTAGCTGCAGGATCTCCAGCTGG - Intronic
936953401 2:118000859-118000881 GGATCTGGTGGGGCTCCAGCTGG + Exonic
937982315 2:127622932-127622954 GGTCCTCCTGGACCTCCAGTGGG - Intronic
940868971 2:158844089-158844111 GAACCTGGTTGACCTCCAGCAGG + Intronic
944513105 2:200483948-200483970 AAACCTGCTGGGACTCCAGCTGG + Intergenic
945794115 2:214340579-214340601 GCACCTGCTGCTGCTCCAGCAGG + Intronic
946414284 2:219531850-219531872 GATCATGCTGGACATCCAGCAGG + Exonic
947165148 2:227254157-227254179 GGACCTCCTGGACCCTCAGTAGG + Exonic
947716117 2:232339653-232339675 GGATCTGCTGTGCCTGCAGCTGG + Intronic
947727645 2:232409935-232409957 CGTCCTGCCGGACCTCCACCTGG + Exonic
947853740 2:233309197-233309219 GGACTTGCTGGTCTTCCCGCTGG - Exonic
948060732 2:235041840-235041862 AGCCCTGCTGGACCCCCCGCTGG + Exonic
948789568 2:240370324-240370346 GCACCTGCTGGGCCTCTACCCGG + Intergenic
1170571325 20:17634434-17634456 GGAGCTGATGGACCTACAGTGGG - Intronic
1170721371 20:18882587-18882609 GAACCTGATAGAGCTCCAGCAGG + Intergenic
1171107465 20:22448599-22448621 GGACCTGATTTACTTCCAGCTGG - Intergenic
1172005594 20:31817146-31817168 GGACCTCCTGGCCCTCTATCTGG - Intergenic
1172884560 20:38222516-38222538 CGGCCTACTGGGCCTCCAGCGGG - Exonic
1175159199 20:56995410-56995432 GGTGCTGCCGCACCTCCAGCAGG - Intergenic
1175624411 20:60478519-60478541 CCACCTGCTGGACTTCCAGGAGG + Intergenic
1176141457 20:63546824-63546846 GCACCAGCTGGACACCCAGCAGG - Intronic
1176147087 20:63570366-63570388 GCACCTGCGTGACCTGCAGCAGG - Intronic
1180000859 21:44994968-44994990 TGACCGCCTGGACCTGCAGCAGG + Intergenic
1180105016 21:45612839-45612861 GGACATGCAGGCCCTGCAGCTGG - Intergenic
1180999149 22:19979899-19979921 GGCACTGCTGGACCACCCGCGGG - Exonic
1181104297 22:20564451-20564473 CCACCTGCTGGAGCTGCAGCTGG - Exonic
1181171266 22:21011564-21011586 GGACCTGTTGGAGAACCAGCTGG - Intronic
1182327878 22:29528004-29528026 GGACCCTCTGCACCTGCAGCTGG + Intronic
1183425555 22:37737330-37737352 GGAGCAGCTGGAGCCCCAGCAGG - Intronic
1183461562 22:37953979-37954001 GGCCCTCCTGTGCCTCCAGCCGG - Intronic
1184401529 22:44277345-44277367 GTACCTGGAGGGCCTCCAGCAGG - Intronic
1185153671 22:49180490-49180512 TCACCTCCTGGACCTCCGGCTGG + Intergenic
950416647 3:12872746-12872768 GGGCCTTCTGGACCTTCATCAGG - Intergenic
951436434 3:22670472-22670494 GGACTTCCTGGACCACCAGTGGG + Intergenic
952190230 3:31015152-31015174 GGACAGCCTGGATCTCCAGCTGG + Intergenic
952289823 3:32004284-32004306 GGACCTGGAGGGCCTCCAGCAGG + Intronic
952593606 3:34988406-34988428 GGACCAGCTGGAGTTCCAGGTGG + Intergenic
952984840 3:38770174-38770196 TGAGCTGTTTGACCTCCAGCCGG + Intronic
953072251 3:39532528-39532550 AGACCTGCTGGCCCTGCAGGAGG - Intergenic
953409018 3:42678643-42678665 GGTGCTGCTGGAGCTCCTGCTGG + Intergenic
953679846 3:45030894-45030916 GGGCCTGCTGCTCCTTCAGCAGG - Exonic
954665483 3:52249191-52249213 GGACCAGCTGGAGCTACAGGAGG + Exonic
954689548 3:52388423-52388445 GGTCATCCTGGGCCTCCAGCAGG - Exonic
957696811 3:83649855-83649877 GGACTTGCTGGAGCTCCTGCAGG + Intergenic
959606828 3:108250203-108250225 GGACCAGATGGACCTGAAGCAGG + Intergenic
960809033 3:121610943-121610965 GGAACTGCTGTACCTCCTACTGG + Intronic
961785375 3:129344071-129344093 GGAGCTGCGGGACCTGCAGAGGG + Intergenic
965696947 3:171418918-171418940 GACCCTGCTGGACCTCAATCTGG - Intronic
966930586 3:184673088-184673110 GGCCCTGGTGGACCTGCAGTTGG + Intronic
967891186 3:194365692-194365714 GGACCTGCTGGACCTCCAGCAGG + Intronic
967891188 3:194365695-194365717 GGCCCTGCTGGAGGTCCAGCAGG - Intronic
968087036 3:195878448-195878470 GGCCCTGCGGGACTTCCTGCTGG - Exonic
968184812 3:196625298-196625320 GGACCTGCTGAAAGTCCATCCGG - Intergenic
968696710 4:2033906-2033928 GGAGTTGCTGGAACTCCTGCAGG + Intronic
968904992 4:3446916-3446938 GGCCCTGCAGAACCTGCAGCCGG + Intronic
969227498 4:5808291-5808313 GGACCTTCTGGAAGCCCAGCTGG + Exonic
970398515 4:15695659-15695681 GGACTCTCTGGGCCTCCAGCCGG + Intronic
974377257 4:61094856-61094878 TGAAGTGCTGGACCTACAGCTGG - Intergenic
975686886 4:76924928-76924950 GGAACTGCTGGACATCCAGTTGG + Intergenic
976095293 4:81502052-81502074 GTAACTGCTGGACATCCAGAGGG - Intronic
976554400 4:86433324-86433346 GGCCCTCCAGGACCCCCAGCTGG + Intronic
985481428 5:113418-113440 GGCCCTGCAGCACCTGCAGCAGG + Intergenic
985572941 5:660021-660043 GGCCCTGCTGTTCCTCCTGCAGG - Exonic
986275572 5:6272224-6272246 GGGCCTGCAGGATCACCAGCTGG - Intergenic
986310168 5:6545463-6545485 GGACCTCCCAGGCCTCCAGCAGG + Intergenic
987068833 5:14316725-14316747 TGACCTGCTGAACGTCCTGCTGG - Exonic
991373883 5:65945472-65945494 GGAGCTCCTGGATCTCCATCAGG - Intronic
991647413 5:68815086-68815108 GAACCTGCTGGACTTCCTGGAGG + Intergenic
992479234 5:77134190-77134212 GGCACAGCTGGAGCTCCAGCTGG + Intergenic
993933881 5:93976641-93976663 GGACCTTCTTCACATCCAGCAGG - Intronic
994229937 5:97301191-97301213 GGGCCAGCTGGAGTTCCAGCTGG + Intergenic
994229939 5:97301194-97301216 TGCCCAGCTGGAACTCCAGCTGG - Intergenic
994843160 5:104951740-104951762 GGAGTTGCTGGAGTTCCAGCAGG + Intergenic
995568650 5:113457190-113457212 GGCCCACCTGGAACTCCAGCTGG - Intronic
998413390 5:141928159-141928181 GGCCGTGCTGGCCCTGCAGCTGG + Exonic
1002315792 5:178342222-178342244 AGACCTGCTGGAGCTCCAGGTGG - Intronic
1003196080 6:3916003-3916025 AAACCTGCTGGAGCTCCAGTAGG + Intergenic
1007570978 6:42890695-42890717 GGCCCTGCTGGACCAGCTGCAGG + Exonic
1011791761 6:90906713-90906735 GGACCTGCTGTACCTACACTTGG + Intergenic
1012530719 6:100232472-100232494 GGACCTCCTCGAGGTCCAGCAGG + Intergenic
1013980301 6:116121163-116121185 GGACCTGCTGGCCTTCCTGGGGG - Exonic
1014009811 6:116462412-116462434 GGACGTGCAGGACCTCCTGAAGG + Exonic
1015057098 6:128916825-128916847 AAACCTGTTGGCCCTCCAGCTGG + Intronic
1016479577 6:144467620-144467642 GGGCGTGCTGGAGCTCCAACAGG + Intronic
1017006755 6:150032992-150033014 GCAACTGCTGGACATTCAGCTGG + Intergenic
1017826682 6:158086862-158086884 GGACCTGGTGGAGCTCAAGCGGG + Exonic
1019428276 7:987396-987418 GAGCCTGCTGGTCCTCCAGCCGG - Exonic
1019526025 7:1480898-1480920 GCTCATGCTGGACCTCCACCAGG + Exonic
1019732067 7:2633969-2633991 TGACCTGCCTGGCCTCCAGCAGG + Intronic
1021406277 7:20270762-20270784 TGACCTGCTGGAAAGCCAGCTGG + Intergenic
1026955943 7:74376543-74376565 GGGCCTCCTGCAGCTCCAGCCGG - Exonic
1030365189 7:108637612-108637634 GGCCCTGCTGGGCCCACAGCTGG - Intergenic
1032591965 7:133200004-133200026 AGATCTGCTGGGCCTCCTGCTGG + Intergenic
1035778685 8:2209679-2209701 GGACCTGTGGGACTTCCTGCAGG + Intergenic
1036621470 8:10426966-10426988 GGACCTGCTGGGCCTTCTGCTGG + Intronic
1037787718 8:21912435-21912457 GGCCCTCCTGCAGCTCCAGCCGG + Exonic
1038840232 8:31177829-31177851 GGTCCTGGTGGAGCTCCAGTGGG - Intergenic
1040015135 8:42693394-42693416 GGAGCTCATGGACCTCCAGAAGG + Intergenic
1044295580 8:90523330-90523352 GGACCTGCTGGACTCCTGGCAGG - Intergenic
1045930026 8:107611383-107611405 GCAACTGCTCAACCTCCAGCAGG + Intergenic
1045956623 8:107915636-107915658 GGAACTGCTGAAAGTCCAGCAGG + Intronic
1046034213 8:108821644-108821666 GGGCCTGTTGGAGCTACAGCTGG - Intergenic
1046502260 8:115093781-115093803 GGACCTGGTAGAACTCCTGCAGG + Intergenic
1048329966 8:133464683-133464705 GGTCCTGCTGTGCCTCCACCGGG - Intronic
1049206183 8:141364721-141364743 TGACATGCAGGACCTCCAACTGG - Intronic
1049586999 8:143436885-143436907 GGCCCTGCTGGGATTCCAGCCGG - Intergenic
1053067016 9:35075979-35076001 GGACCTGCTGGCCCTGTTGCTGG - Exonic
1055406006 9:75974255-75974277 GGACCGACGGGAGCTCCAGCCGG + Intronic
1056576335 9:87858310-87858332 GGACCTGTGGGACCTGTAGCCGG + Intergenic
1056722456 9:89083384-89083406 GGACGTGCAGGAGCGCCAGCTGG + Intronic
1056770525 9:89475110-89475132 GAACCTGCAGAACCTGCAGCTGG + Intronic
1056810082 9:89757364-89757386 GGTCCTGCTGGGACTGCAGCTGG + Intergenic
1057481674 9:95449470-95449492 GGACCTGAAGGTCCTCCAGGTGG - Intronic
1059332260 9:113542998-113543020 CTGCCTGCTGCACCTCCAGCTGG + Intronic
1062231666 9:135485344-135485366 GGGCCTGCTGGGCGTCCAGAAGG + Exonic
1062535895 9:137020959-137020981 GAACCTTCTGGGCATCCAGCAGG + Exonic
1062535896 9:137020962-137020984 GGACCTGCTGGATGCCCAGAAGG - Exonic
1062606029 9:137349244-137349266 GGGCTTGGTGCACCTCCAGCAGG + Exonic
1185593598 X:1294205-1294227 GGACCTACTCCACCTCCACCTGG + Intronic
1191766697 X:64705750-64705772 GGAGCTGGTGGACTTCCTGCAGG + Intergenic
1192731074 X:73803197-73803219 CTATCTGCTGGTCCTCCAGCAGG - Intergenic
1196828517 X:119758892-119758914 GGAACTGCTGGGGCTGCAGCGGG + Exonic
1200256118 X:154584394-154584416 GGACCTGCTGGACCTGAGGCTGG - Intergenic
1200261651 X:154620009-154620031 GGACCTGCTGGACCTGAGGCTGG + Intergenic
1200267633 X:154654306-154654328 GGACCTGCTGGACCTGAGGCTGG + Intergenic
1200846473 Y:7836101-7836123 GGACCTGCTCTACCTCCTTCAGG + Intergenic