ID: 967891931

View in Genome Browser
Species Human (GRCh38)
Location 3:194369788-194369810
Sequence GTCACTGCAGAGGGCAGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 319}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967891924_967891931 5 Left 967891924 3:194369760-194369782 CCCGGTATTTAAACTATCCCGGG 0: 1
1: 0
2: 0
3: 0
4: 57
Right 967891931 3:194369788-194369810 GTCACTGCAGAGGGCAGTGTTGG 0: 1
1: 0
2: 2
3: 44
4: 319
967891922_967891931 15 Left 967891922 3:194369750-194369772 CCTAAGCTGTCCCGGTATTTAAA 0: 1
1: 0
2: 1
3: 2
4: 50
Right 967891931 3:194369788-194369810 GTCACTGCAGAGGGCAGTGTTGG 0: 1
1: 0
2: 2
3: 44
4: 319
967891926_967891931 4 Left 967891926 3:194369761-194369783 CCGGTATTTAAACTATCCCGGGC 0: 1
1: 0
2: 0
3: 0
4: 29
Right 967891931 3:194369788-194369810 GTCACTGCAGAGGGCAGTGTTGG 0: 1
1: 0
2: 2
3: 44
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967891931 Original CRISPR GTCACTGCAGAGGGCAGTGT TGG Intergenic
900089897 1:915569-915591 GTCTCTGCAAAGGGCTGTGTGGG + Intergenic
900524161 1:3120353-3120375 GTCACCGCAGAAGGGAGTTTTGG + Intronic
900745583 1:4358504-4358526 ATCACAGCAGACAGCAGTGTTGG + Intergenic
901035127 1:6331828-6331850 GTCTCCTCAGAGGGCAGTGAAGG - Intronic
902070458 1:13730593-13730615 TTCATTGAAGTGGGCAGTGTTGG + Intronic
902375017 1:16026517-16026539 GGCCCTGCAGAGGGAAGGGTGGG - Exonic
903210603 1:21816063-21816085 CTGACTGCAGAGGTCAGTGCGGG + Exonic
903515700 1:23909425-23909447 GTCTCGGGAGAGGGCAGAGTGGG - Intronic
904005917 1:27363154-27363176 GTCACTAGAGAGGTCAGTGCTGG - Intronic
904093629 1:27961317-27961339 GTCAGGGCAGAGGGTGGTGTGGG + Intronic
904482269 1:30801584-30801606 GTGACTGCAGAGAGCAGAGGGGG - Intergenic
904629547 1:31830621-31830643 GTGACTGCATAGAGCACTGTCGG - Intergenic
906681325 1:47727591-47727613 GACACGGGAGAGGCCAGTGTGGG + Intergenic
907318941 1:53590776-53590798 GGCCGTGCAGAGGGCAGGGTGGG + Intronic
908179989 1:61593956-61593978 GTTATGGCAGCGGGCAGTGTGGG - Intergenic
908247081 1:62236064-62236086 GTCTCTGCAGACAGCAGTATGGG - Intergenic
909948365 1:81689665-81689687 GTGGCTGCAGGGGGCTGTGTGGG + Intronic
912802714 1:112730579-112730601 TTCACAGCTGAGGACAGTGTGGG - Intergenic
912974839 1:114319461-114319483 TTCACTGCAGAGAGTAGTTTAGG + Intergenic
913426581 1:118738075-118738097 GGCACTGAAGTGGGCAGTCTGGG + Intergenic
916890204 1:169106410-169106432 GTCTCTGCAGAGGTCAGGGGAGG + Exonic
917963892 1:180166539-180166561 GTCTCTGCAGACTGCACTGTTGG - Exonic
919819345 1:201463141-201463163 TTGGCTGCAAAGGGCAGTGTAGG - Intergenic
920074000 1:203323834-203323856 GCCACTGCAGAGGGCTGAGCTGG - Intergenic
920559018 1:206925700-206925722 GTCATTGCAGAGAACAGTGTTGG - Intergenic
921895465 1:220395394-220395416 GTAACTGAAGAGGACAGAGTAGG - Intergenic
924354988 1:243163333-243163355 GTGGCTGCAAAGGCCAGTGTGGG - Intronic
1062820910 10:534048-534070 GTCACTGCAGAAGGGGGCGTGGG - Intronic
1063482367 10:6386767-6386789 GACACTGCAGAGTCCACTGTGGG + Intergenic
1064034325 10:11902885-11902907 GCCACTGAAGAGGGCAGGCTCGG - Intergenic
1065422203 10:25557528-25557550 GTCACTGGAGGCGGCAGGGTGGG - Intronic
1066638592 10:37532925-37532947 GTCAGGGCAGAAGGCAGTGTTGG - Intergenic
1067238742 10:44472887-44472909 GACACAGCAGAGGGAAGTGAGGG - Intergenic
1069230655 10:66005279-66005301 GTGACTCCTGAGGGCTGTGTAGG - Intronic
1071568609 10:86684416-86684438 CCCCCTGCAGAGGGCAGTGTTGG - Intronic
1072805172 10:98419441-98419463 GCCACTGCACAGGGCTGTGAGGG - Intronic
1072948155 10:99829214-99829236 GCCACTGGAGGGGGCAGAGTGGG - Intronic
1073574012 10:104606121-104606143 GCCACTACAGAGGACAATGTAGG - Intergenic
1073706605 10:105990450-105990472 GTCATGGCAGAAGGCTGTGTGGG - Intergenic
1074447300 10:113530944-113530966 GACACTGCTCAGGGCAATGTGGG + Intergenic
1075296434 10:121280127-121280149 TTGGCTGCAGAGGTCAGTGTTGG + Intergenic
1075418032 10:122279964-122279986 GACACGGCAGAAGGAAGTGTTGG - Intronic
1076134381 10:128035679-128035701 GGAGCTGCAGGGGGCAGTGTGGG + Intronic
1076569744 10:131424923-131424945 GACACAGCAGGGGTCAGTGTGGG + Intergenic
1076836961 10:133025942-133025964 GTCAGAGCAGAGGCCAGTGTGGG + Intergenic
1077236624 11:1484951-1484973 GCCTCTGCAGAGGGCACAGTAGG - Intronic
1077360214 11:2137509-2137531 ATCTCTGCACAGGGCAGTGAAGG + Intronic
1077469724 11:2751493-2751515 CTCAGTGCAGAGGGCAGTGGAGG + Intronic
1077506168 11:2930876-2930898 GTGCCGGCAGAGGGCAGGGTTGG + Intergenic
1077554805 11:3220776-3220798 GCCACTGCGGAGGGCAGGGGAGG + Intergenic
1077555609 11:3224588-3224610 GACACAGCAGAGCCCAGTGTTGG - Intergenic
1079133020 11:17760549-17760571 GGGACTGCAGGGGGCACTGTGGG + Intronic
1080411399 11:32028653-32028675 GGCCATGGAGAGGGCAGTGTGGG - Intronic
1081694801 11:45102493-45102515 TGGATTGCAGAGGGCAGTGTTGG - Intronic
1081925651 11:46826277-46826299 GTCTCTCCAGAGGCCTGTGTTGG - Intronic
1083638122 11:64131167-64131189 GGCACTGCAGAGGGAAATGGGGG + Intronic
1083869492 11:65478002-65478024 TGCACTACGGAGGGCAGTGTAGG + Intergenic
1086304142 11:85461553-85461575 GTGACTGAAGAGGCCAGTGATGG + Intronic
1086953420 11:92913301-92913323 GACACTGCAGAGAGGAGGGTGGG + Intergenic
1089916287 11:122160023-122160045 ATCACTGCAGATGACAGTGTAGG + Intergenic
1090601821 11:128380069-128380091 GTCAGTGCAAAGGGCAGCCTTGG + Intergenic
1091985374 12:4906838-4906860 GTCACTGTATTGGGCAGCGTAGG - Intergenic
1096255367 12:50058883-50058905 GTCTCTGAAGCGGGCACTGTGGG + Exonic
1097102857 12:56601595-56601617 GAAACTGCAGGGGGCGGTGTGGG + Exonic
1099362953 12:81729430-81729452 TTCACTGCAAAGTACAGTGTAGG - Intronic
1100456418 12:94755955-94755977 GTTTCTGTTGAGGGCAGTGTAGG + Intergenic
1101373310 12:104150005-104150027 GAAACTGCAGAGGGAAGTGGAGG + Intergenic
1102997893 12:117363489-117363511 GTGCCTGCAGAAGGCAGAGTTGG + Intronic
1103345663 12:120248403-120248425 GTGTCTGCTGAGGGCAGTGGGGG - Intronic
1103473637 12:121201983-121202005 GTGACTGCAAGAGGCAGTGTGGG - Intergenic
1103762971 12:123264789-123264811 GTGACAGCAGAGGGCAGTGCAGG + Intronic
1104595816 12:130119386-130119408 GTCACTGAGGAGGGCTGCGTGGG - Intergenic
1104754744 12:131262002-131262024 GCCACTGCAGAGGGCAGAGAGGG + Intergenic
1104914930 12:132259784-132259806 GTCACTGCAGGGGGCCTTGGTGG - Intronic
1106118633 13:26838711-26838733 GTCCCTGCGGACGGAAGTGTTGG + Intergenic
1106200117 13:27528884-27528906 ATCACTGCAGAAGGCTGAGTGGG - Intergenic
1106546384 13:30734355-30734377 GGCACGGAAGAGGTCAGTGTAGG - Intronic
1106609374 13:31263868-31263890 GTCACTGCAGCAGGGTGTGTAGG + Intronic
1108381550 13:49859681-49859703 GTCACTGCAGTGGACAGTCATGG + Intergenic
1109759762 13:66812558-66812580 TTCACTGCCTAGGGCACTGTTGG + Intronic
1110225796 13:73117974-73117996 TTGACTGCAGAGGGGAGAGTTGG + Intergenic
1110512396 13:76366370-76366392 ATCATGGCAGAGGGCAGTGCTGG - Intergenic
1112173092 13:96994152-96994174 GTCCCTGCAGCAGGCAGGGTCGG - Intronic
1112764362 13:102724994-102725016 GTCACTGCAGAGCGCATGTTTGG - Intergenic
1113117347 13:106887304-106887326 TTCACTCCAGAGGGCAGAGATGG + Intergenic
1113352879 13:109546778-109546800 GTCAGTACAGATGGCAGAGTTGG - Intergenic
1114534862 14:23416349-23416371 GTCAGGGCACAGGGCAGGGTGGG + Intronic
1116356424 14:43936874-43936896 GGCAGTGCAGAGGGAAATGTGGG - Intergenic
1117316604 14:54577077-54577099 GTCACTGCTGTGGGCAGTGGGGG + Intronic
1118263299 14:64268615-64268637 GTAACTGCAGAGGACAGAGCTGG - Intronic
1119180972 14:72605060-72605082 GGCACTGTAGAGGGCAGGTTTGG + Intergenic
1121743327 14:96269047-96269069 CCCACTGCAGAGAGCAGTGAAGG - Intergenic
1122462317 14:101905764-101905786 ACCACTGCAGAGGGCAGTGGGGG - Intronic
1122713218 14:103676131-103676153 TCCTCTGCAGAGGGAAGTGTAGG + Intronic
1202839902 14_GL000009v2_random:111836-111858 GACACTGGACAGGGCAGTGTGGG - Intergenic
1202906076 14_GL000194v1_random:73150-73172 GTCACTGCTGAAGGCTGTGGTGG + Intergenic
1202909285 14_GL000194v1_random:102034-102056 GACACTGGACAGGGCAATGTGGG - Intergenic
1202883989 14_KI270722v1_random:87242-87264 GACACTGGAGAGAGCGGTGTGGG + Intergenic
1123817171 15:23991866-23991888 GTCACTGCAGAGTTCCATGTGGG - Intergenic
1124591136 15:31054070-31054092 GTCACAGGAGAGGGCAGGATGGG + Intronic
1125535057 15:40437784-40437806 GGGACTGCAGCGGGCAGTGGCGG + Intergenic
1127583525 15:60359845-60359867 ATATCAGCAGAGGGCAGTGTCGG + Intronic
1127824548 15:62691194-62691216 GTAACAGGAGAGGACAGTGTTGG - Intronic
1130510098 15:84582206-84582228 GCCAGGGCAGAGGACAGTGTGGG - Intergenic
1131593678 15:93774975-93774997 GACATTGCACAGTGCAGTGTGGG - Intergenic
1132641346 16:979961-979983 GGCACTGCAGACGGAGGTGTGGG + Intronic
1132980829 16:2738007-2738029 ATCCCTACAGAGGGCAGAGTGGG - Intergenic
1132981909 16:2742623-2742645 GTCCCTGCAAAGGGCAGAGTGGG - Intergenic
1133008733 16:2898483-2898505 GTCCCTGCAGAGGGCAGAGGGGG + Intronic
1135190819 16:20353040-20353062 GTCACTGACAAGGGCAGGGTGGG + Intronic
1135623647 16:23976865-23976887 GTTACTGCAGAGGGAAGGGTAGG + Intronic
1135927766 16:26710211-26710233 GACAATGCAGAGGGCAGTTGTGG + Intergenic
1136232434 16:28894564-28894586 GTCATTGCAGAGGGCACAGATGG - Exonic
1138883893 16:61050978-61051000 GTCGCTCCAGTGGGCAGTGTTGG + Intergenic
1141124601 16:81392214-81392236 CTCAATGCAGAGGGCAGAGCTGG + Intergenic
1141842583 16:86583643-86583665 ATCACTGGAGCGGGCAGTGGTGG + Intergenic
1142164182 16:88576962-88576984 TTCTCTGCAGAGTGGAGTGTGGG + Intronic
1142224236 16:88869865-88869887 GTCACTGGAAAGGCCAGGGTCGG - Intergenic
1142737468 17:1910371-1910393 GTCATTGCTGAGGGCAGGCTCGG + Intergenic
1142747186 17:1965740-1965762 GTCAGCGCTGAGGGCAGTGGGGG - Intronic
1143656448 17:8296526-8296548 GGGACTGCAAAGGACAGTGTTGG - Intergenic
1144319842 17:14104067-14104089 GACACTGCAGAGGGCTGTGTGGG - Intronic
1144786493 17:17835295-17835317 ATCACTCCAGAGGGCAGTGAAGG + Intronic
1144958147 17:19029925-19029947 TTCACTTCAGTGGGCAGTGCCGG + Intronic
1144977011 17:19144595-19144617 TTCACTTCAGTGGGCAGTGCCGG - Intronic
1147409549 17:40239637-40239659 GTCACAGCTAAGGGCAGTGACGG - Intronic
1147724666 17:42559276-42559298 GCCACTGCACTGGGCAGGGTGGG - Intergenic
1150248924 17:63695500-63695522 TTGTCTTCAGAGGGCAGTGTGGG - Exonic
1150984128 17:70176091-70176113 GGCACTACAAAGGGGAGTGTTGG - Exonic
1151813406 17:76458731-76458753 GCTCCCGCAGAGGGCAGTGTTGG - Intronic
1152046092 17:77936851-77936873 GTGCCTGCAGAGGTCTGTGTGGG - Intergenic
1152240790 17:79159968-79159990 TGCACTTCAGAGGGCAGTGGGGG - Intronic
1152600393 17:81259339-81259361 GCCTCTGCAGAGGGGTGTGTTGG + Intronic
1152839980 17:82561230-82561252 GTCACTGCTGAGGGGAGTCCTGG + Intronic
1153533994 18:6080562-6080584 GCCTCTGCAGATGGCAGAGTGGG + Intronic
1157230419 18:45910590-45910612 GTTCCAGCAGAGGGCAGTGAAGG - Exonic
1158165861 18:54539401-54539423 GTCAGTACAGATGGCAGTGGTGG - Intergenic
1158706543 18:59797446-59797468 CTCACTGCTGAGGCCAGTGTAGG + Intergenic
1159438474 18:68447597-68447619 GTCTCTGCAGGGGGCATTCTGGG + Intergenic
1159651750 18:70986415-70986437 GGCAATGCAGAGGGAAATGTAGG + Intergenic
1159925868 18:74268617-74268639 GCCACTCCAGAGGGTAGGGTGGG + Intronic
1159963982 18:74578473-74578495 GTCACTGCACTGGGCAATATTGG - Intronic
1160007034 18:75075370-75075392 CTCCCTGCAGAGGGCAGGGCTGG + Intergenic
1161085978 19:2335034-2335056 GTAACAGCAGAGGGCACAGTGGG + Intronic
1163145097 19:15374429-15374451 GGGACTGCAGAGGGCTGTGGTGG - Intronic
1163689410 19:18730554-18730576 GTCACTGCAGAGGGACGGGGAGG - Intronic
1164888057 19:31800280-31800302 GTCTCTTGAGAGGGCAGGGTCGG + Intergenic
1165591548 19:36973495-36973517 AGCTCGGCAGAGGGCAGTGTCGG + Intronic
1165723440 19:38095882-38095904 TTCCCAGCAGAGGGCACTGTGGG + Intronic
1165912705 19:39238810-39238832 CTCAGTGCACAGGACAGTGTTGG - Intergenic
1167529046 19:50003407-50003429 GAAGCTGCAGAGGGCAGCGTGGG + Intronic
1168033889 19:53703521-53703543 GCCACTGCAGAGGCCAGGGTCGG + Intergenic
1202633149 1_KI270706v1_random:18726-18748 GACACTGGACAGGGCTGTGTTGG + Intergenic
1202652730 1_KI270707v1_random:21328-21350 GACACTGGACAGGGCGGTGTGGG - Intergenic
1202659415 1_KI270708v1_random:54415-54437 GACACTGGAGAGAGCGGTGTGGG + Intergenic
925553223 2:5098795-5098817 GTCACTGAAGAGGACATAGTTGG - Intergenic
926651899 2:15355747-15355769 CTCACAGCAGAAGGCAGAGTGGG - Intronic
927467470 2:23348138-23348160 GCTGCTGCAGAGGGCAGTGTGGG + Intergenic
927467478 2:23348170-23348192 CCTGCTGCAGAGGGCAGTGTGGG + Intergenic
927467486 2:23348202-23348224 CCTGCTGCAGAGGGCAGTGTGGG + Intergenic
927467496 2:23348234-23348256 CCTGCTGCAGAGGGCAGTGTGGG + Intergenic
927467504 2:23348266-23348288 CCTGCTGCAGAGGGCAGTGTGGG + Intergenic
927467514 2:23348298-23348320 CCTGCTGCAGAGGGCAGTGTGGG + Intergenic
927467522 2:23348330-23348352 CCTGCTGCAGAGGGCAGTGTGGG + Intergenic
927467530 2:23348362-23348384 CCTGCTGCAGAGGGCAGTGTGGG + Intergenic
927661886 2:25000501-25000523 ATCACTGCAGAGGCCACAGTGGG + Intergenic
927989454 2:27437252-27437274 CTCACTGAAGATGGCAGTGCTGG + Exonic
928000658 2:27520446-27520468 GTCACTTTAGAGCGCAGTGAGGG + Intronic
928230699 2:29496393-29496415 GTCACTGCATATGGCAGTGCAGG + Intronic
930037490 2:47096018-47096040 GTCTCTGCAGTCGGCAGTTTAGG - Intronic
931161040 2:59691013-59691035 TTCAGTGCAGAGGGCTGTGCTGG + Intergenic
931386584 2:61803428-61803450 GGTACTGCAAAGGCCAGTGTTGG + Intergenic
931998928 2:67866015-67866037 ATCACTTCAGAGGGCAGTAGAGG + Intergenic
932087794 2:68777001-68777023 GTCACTGCAGAGGCCAGGGAAGG + Intronic
932895790 2:75638110-75638132 GTCACTGCAGAGTGGAGAATGGG - Intergenic
933550030 2:83764832-83764854 CTCTCAGCAGAGGGCGGTGTGGG - Intergenic
933692534 2:85190422-85190444 GCCTCTGCAGAGGCCAGTCTTGG + Intronic
933822142 2:86122871-86122893 GGCATTGCAGAGGTCAGTGTTGG - Intronic
934792093 2:97070103-97070125 GTCACTGCTGTGGGCAGCGGTGG - Intergenic
934814526 2:97313607-97313629 GTCACTGCTGTGGGCAGCGGTGG + Intergenic
934823167 2:97394876-97394898 GTCACTGCTGTGGGCAGCGGTGG - Intergenic
935413740 2:102792985-102793007 GTCAAGGCAGCGGGCAGTGGAGG - Intronic
935647068 2:105346677-105346699 GTCACTGCAGAGTGCAACATAGG + Exonic
936057541 2:109272182-109272204 GTCATTGCAGAGGGCTGTGGGGG - Intronic
937323867 2:120977512-120977534 GTCACTGCATTAGACAGTGTGGG + Intronic
938766059 2:134461089-134461111 GGCACTGCAGAGGGGAGTGACGG - Intronic
943833609 2:192491052-192491074 GCCACTGCAGAAAGCAGTTTGGG + Intergenic
945109541 2:206349246-206349268 GGCAATGCAGAGGGAAATGTGGG - Intergenic
945186221 2:207142593-207142615 CTCCCTGCAGAGGTCAGTGAAGG + Intronic
945884656 2:215362631-215362653 GTCACTGCCTAGGGAAGTTTAGG - Intronic
946864065 2:224027085-224027107 CTCTCTGCAGAGGGAAATGTTGG - Intronic
947653328 2:231805942-231805964 GTCATTACAGAGGGCAGGCTGGG - Intronic
947854028 2:233311238-233311260 GTCAAAGAAGAGGGCAGCGTCGG - Intronic
948505149 2:238423279-238423301 GGGACTGCAGAGGACAGTGTGGG - Intergenic
948938124 2:241181628-241181650 GGCAGGGCAGTGGGCAGTGTGGG + Intronic
1170310090 20:14982794-14982816 GGCAGTGCATTGGGCAGTGTGGG + Intronic
1170606557 20:17879009-17879031 GTTGCCGCAGGGGGCAGTGTGGG + Intergenic
1172199974 20:33118563-33118585 GTCAATGCAGGGTGCAGTGATGG - Intergenic
1172204162 20:33150550-33150572 ATCACTGCAGAGAGCAGGCTGGG - Intergenic
1176172836 20:63703884-63703906 GTCACAGCAGTGGTCATTGTGGG + Intronic
1176245274 20:64094183-64094205 GTCAGTGTGGGGGGCAGTGTGGG + Intronic
1176245305 20:64094276-64094298 GTCAGTGTGGGGGGCAGTGTGGG + Intronic
1176599422 21:8778325-8778347 GACACTGGACAGGGCGGTGTGGG + Intergenic
1176628637 21:9116746-9116768 GACACTGGACAGGGCAATGTGGG - Intergenic
1177836107 21:26187932-26187954 GTTACTGCATGGGGCAGTGTTGG - Intergenic
1178632097 21:34270720-34270742 GCCACTGGAGATGGCAGTGGAGG + Intergenic
1179064790 21:38014958-38014980 GTCTCTGGGGAGGGCAGAGTGGG + Intronic
1179562709 21:42226343-42226365 GTCTCTGGAGAGGTCAGTCTAGG - Intronic
1179590990 21:42407677-42407699 GTCACTGAGGAAGGCAGTGCTGG + Intronic
1180251847 21:46595373-46595395 GACACTGCAGAGGGCATATTGGG - Intergenic
1180326877 22:11437941-11437963 GACACTGGAGAGAGCGGTGTGGG + Intergenic
1180419008 22:12796576-12796598 GACACTGGACAGGGCGGTGTTGG - Intergenic
1181304317 22:21906128-21906150 GGCACTGGAGATGTCAGTGTGGG - Intergenic
1181560213 22:23695635-23695657 GTGTCTGCAAAGGGCAGAGTGGG - Intronic
1183109259 22:35637047-35637069 GTCCCAGCAAAGGGCAGAGTTGG + Intronic
1183355390 22:37356129-37356151 GTCACTGCAGAGGGCACTGCAGG + Intergenic
1183683974 22:39350961-39350983 CTCAGTGCAGAGGGCTGAGTGGG + Intronic
1183745300 22:39688332-39688354 CTCTCTGGAGCGGGCAGTGTTGG - Exonic
1184622215 22:45689451-45689473 GTAAATGGAGAGGACAGTGTTGG + Intronic
1185122647 22:48981738-48981760 GTCTGTGCACAGGGCAGTGGGGG + Intergenic
1185257802 22:49845798-49845820 GCCACTGATGATGGCAGTGTGGG - Intergenic
1185361174 22:50407945-50407967 GAGACTGCAGTGGGCTGTGTTGG - Intronic
949657019 3:6232500-6232522 ATCTCTGCAGAGAGCAGAGTTGG + Intergenic
949780673 3:7683615-7683637 GTCACTGCAGAAAGTACTGTTGG - Intronic
950554861 3:13689276-13689298 GTCACTGCTGTGGGCAATGAGGG + Intergenic
951439295 3:22704774-22704796 ATGACTCCAGAGGGCAGTGCTGG - Intergenic
951439433 3:22706549-22706571 GTGACTCCACAGGGCAGTGCTGG + Intergenic
951630931 3:24719497-24719519 GTCATGGCAGAAGGCAGAGTGGG + Intergenic
952935556 3:38395791-38395813 GTGACTCCAGAGGACAGTGCTGG - Intronic
954050297 3:47970001-47970023 GTCACTGCTGTGGGCAAAGTGGG - Intronic
954130785 3:48559754-48559776 GTCAGTGCAGAGGGCACCCTGGG - Intronic
954415623 3:50391907-50391929 GTCACTGCTGTGGGCTGTGGGGG + Intronic
954699838 3:52445452-52445474 GTCTCTGCTGTGGGCAGTGGAGG - Intergenic
954874331 3:53791583-53791605 GTCTCTGCAGAGAGCAGGGCCGG - Intronic
955169286 3:56547679-56547701 GACACAGCAGATGGCAGTGTGGG - Intergenic
955220915 3:57022693-57022715 GTGACTGGACAGGGCAGTCTCGG - Intronic
955390988 3:58522093-58522115 GTCAGTGCCCAGGGCAGAGTGGG + Intronic
956031172 3:65039764-65039786 ATCATTGCAGGGGGCTGTGTGGG - Intergenic
957415805 3:79902294-79902316 GTCACTGGAGAGTGTAATGTGGG + Intergenic
960104254 3:113776879-113776901 GACACTGCAGAGGGTAGCGGGGG - Intronic
960224955 3:115158040-115158062 GGCAGTGCAGAGGGAAATGTAGG + Intergenic
960275114 3:115720266-115720288 GTCCCTAGAGAGGGCAGAGTTGG - Intronic
960943081 3:122947163-122947185 GTCACTGAAGAGGACAGAGGGGG - Intronic
961135097 3:124502703-124502725 GTCACTGCCCAGGGGACTGTGGG + Intronic
962417111 3:135193202-135193224 GTAAATGCAGAGAGCAGTCTGGG - Intronic
962850871 3:139307390-139307412 GGCTCTGCAGAGGGCAGTGGAGG - Intronic
966869081 3:184278363-184278385 GTCACAGGAGAGGGAAGTCTGGG - Intronic
966889235 3:184394738-184394760 GGCGCTGCAGAAGGCACTGTAGG - Intronic
967891931 3:194369788-194369810 GTCACTGCAGAGGGCAGTGTTGG + Intergenic
968546410 4:1201102-1201124 GTGACCGCAGAGGGCCATGTGGG - Intronic
969389417 4:6879804-6879826 GGCACTGCAGATGGGTGTGTTGG - Intronic
969389439 4:6879928-6879950 GGCACTGCAGACGGGTGTGTTGG - Intronic
969389498 4:6880355-6880377 GGCACTGCAGACGGGTGTGTTGG - Intronic
972482237 4:39507876-39507898 GTCACTGCAGTGAGCAGCGATGG + Intronic
973027659 4:45293159-45293181 TTCACTCCTGTGGGCAGTGTTGG + Intergenic
973051907 4:45608394-45608416 GCCTCAGGAGAGGGCAGTGTGGG - Intergenic
973362776 4:49180697-49180719 GACACTGGACAGGGCGGTGTTGG + Intergenic
973398321 4:49616156-49616178 GACACTGGACAGGGCGGTGTTGG - Intergenic
975484356 4:74917708-74917730 TTCACTTCAGAGGGCAGGGCTGG + Intergenic
977919447 4:102626937-102626959 GGCCTTGGAGAGGGCAGTGTGGG - Intergenic
978846976 4:113285357-113285379 GTCTGTGCAGAGGGCAGTCTTGG - Intronic
979147303 4:117260917-117260939 GTCACGGCACTGGGCAGTCTGGG - Intergenic
979246815 4:118516303-118516325 GTGGCTGCAAAGGCCAGTGTGGG + Intergenic
981610753 4:146591126-146591148 ATCACTGCAGAGGGAAGTCAGGG + Intergenic
983663951 4:170161346-170161368 GTCTCTGGAGCAGGCAGTGTGGG + Intergenic
984635138 4:182102127-182102149 GACACTGCTGAGGCCTGTGTAGG + Intergenic
984902617 4:184598750-184598772 AACACTGCAGAGGACAGTGGCGG + Intergenic
985871448 5:2560593-2560615 ATCGCTGCAGAGGGGTGTGTAGG - Intergenic
985875849 5:2593513-2593535 CTCACAGCAGTCGGCAGTGTGGG + Intergenic
986174690 5:5341721-5341743 GTGGCTGCAGTGGGCAGTGGGGG + Intergenic
986280473 5:6318032-6318054 GCCTCTGGAGAGGGCAGGGTGGG + Intergenic
989187093 5:38636114-38636136 GTCACTGCAGCGGGCAGAGATGG + Intergenic
990914714 5:60891937-60891959 GGCAATGCTGATGGCAGTGTTGG - Intronic
991707156 5:69369356-69369378 GCCTCTGAAGAGGGCAGTGAGGG + Intronic
992894685 5:81235774-81235796 TTTAATGCGGAGGGCAGTGTAGG + Intronic
995320203 5:110825198-110825220 GTCAGTGCATAGGTAAGTGTGGG + Intergenic
997869125 5:137491422-137491444 TTCACTGCAGAGGGCTGTCATGG - Intronic
998059751 5:139110727-139110749 GGCAGTGCACAGGGCAGGGTGGG - Intronic
998509460 5:142699281-142699303 TGACCTGCAGAGGGCAGTGTTGG - Intergenic
998875718 5:146597003-146597025 GTCACTCCACATGCCAGTGTTGG + Intronic
999536106 5:152519139-152519161 GTCACTGGAGAGGGCAGCTTAGG + Intergenic
999614011 5:153402697-153402719 TTCACTTTAGAGGGTAGTGTGGG - Intergenic
1000074725 5:157774154-157774176 GTGAATGCAGAAGGCAGTGAGGG + Intergenic
1001330682 5:170760279-170760301 TTTACTGCAGATGGCACTGTCGG + Intergenic
1001575886 5:172763625-172763647 TCCACTGCAGAGGGCTGTGCAGG + Intergenic
1002963887 6:1943125-1943147 GTCACTGGAGAGAGCTGTGAGGG - Intronic
1003037623 6:2658880-2658902 GTCTCTGCATGTGGCAGTGTAGG - Intergenic
1003041720 6:2694232-2694254 GTCCCTGCAGAGGGAAAAGTAGG - Intronic
1006563936 6:34937994-34938016 GTCACTACAGAGGGAGGTGTGGG - Intronic
1007745848 6:44042538-44042560 GGCACTGGAGAGCACAGTGTGGG + Intergenic
1007747927 6:44054663-44054685 GGCACTGCAGAGGTCAGAGTGGG + Intergenic
1008220852 6:48852130-48852152 GGCAGTGCAGAGGGAAATGTGGG - Intergenic
1009377528 6:62990829-62990851 GGCAATGCAGAGGGAACTGTGGG - Intergenic
1011004499 6:82628942-82628964 GTATATGCAAAGGGCAGTGTTGG + Intergenic
1011088640 6:83570861-83570883 GGCAGTGCAGAGGGAAATGTGGG + Intronic
1012182282 6:96169131-96169153 GTCACTGTAGTGGACAGTGTAGG - Intronic
1014407484 6:121069242-121069264 GGCAGTGCAGAGGGAAATGTGGG + Intergenic
1015141612 6:129940593-129940615 ATCAGTGAAGAGGGGAGTGTGGG + Intergenic
1015239235 6:131005501-131005523 GTCAGTGGAAAGGGGAGTGTTGG + Intronic
1015371328 6:132456914-132456936 GCCACTGCAGACAGAAGTGTAGG + Exonic
1016835483 6:148472572-148472594 GTCACCGCAAATGGCAGAGTGGG - Intronic
1017578413 6:155832730-155832752 TTCTCTGCAGATGGCACTGTAGG + Intergenic
1019995648 7:4722801-4722823 GACACAGCAGAGGGCTGTGGAGG - Intronic
1020140588 7:5609499-5609521 GTCACAGCAGACAGCAGTGGGGG - Intergenic
1024344985 7:48304394-48304416 GCCACTGCAGAAAGCAGTGTGGG - Intronic
1027417153 7:77985553-77985575 GTCTCTCCAGAGGTCACTGTTGG + Intergenic
1028489798 7:91398622-91398644 GTCACTGCAGAGTGCCCTGAAGG - Intergenic
1028620321 7:92819397-92819419 TTCACTGCAAAGGGCCCTGTGGG + Intronic
1030913729 7:115285616-115285638 GTGGCTGGAGAGAGCAGTGTGGG + Intergenic
1031598708 7:123677397-123677419 GTCACTGGAGAGGCCAGTCTTGG - Intergenic
1032414010 7:131722379-131722401 GTCACTTCACAGGGATGTGTAGG - Intergenic
1032539076 7:132688355-132688377 GTGGCTGCAGAAGGCAGTGGGGG - Intronic
1033539857 7:142346495-142346517 GGCATTGCAGAGGGGAGTGAGGG - Intergenic
1034320215 7:150173157-150173179 GGCAGTGCAGAGGGAAATGTGGG - Intergenic
1035081011 7:156215984-156216006 GTCACTGCAGTGGGCACTCAGGG - Intergenic
1036191416 8:6674182-6674204 GTCAGTGCTGAAGCCAGTGTAGG - Intergenic
1037264769 8:17046185-17046207 TTCACTGAAGAGGGCAGTCTTGG + Intronic
1038483291 8:27916565-27916587 GCCACTGCAGACAGCAGTATGGG + Intronic
1039430089 8:37519317-37519339 GGGACTGCAGAGGGCAGGGGTGG - Intergenic
1040518110 8:48150859-48150881 GCCACTGAAGAGGGGAGTGGAGG + Intergenic
1041628505 8:60058704-60058726 GGGTCTTCAGAGGGCAGTGTGGG - Intergenic
1044157340 8:88863779-88863801 GTCCCTACAGAAGGAAGTGTAGG - Intergenic
1044405263 8:91819010-91819032 GTCACTTCAGACTGCTGTGTTGG - Intergenic
1045685772 8:104710120-104710142 CTCCATGCAGAGGGCAGGGTGGG - Intronic
1047113840 8:121818792-121818814 GACACTGCCGGGGGCAGTATGGG + Intergenic
1047207547 8:122815204-122815226 GGCACTGCAGTGGGCAGGGTCGG + Intronic
1048218656 8:132520424-132520446 GCCACTGGAGAAGTCAGTGTTGG + Intergenic
1048841066 8:138566762-138566784 GTGAGTTCAGAGGGCAGAGTGGG + Intergenic
1049164314 8:141116987-141117009 GTCAGTGCAGTCAGCAGTGTGGG + Intergenic
1049408773 8:142463295-142463317 GAGGCTGCAGAGGGCAGTCTTGG + Intronic
1049823006 8:144647519-144647541 AGCAGTGCACAGGGCAGTGTGGG - Intergenic
1049998670 9:1053159-1053181 GTGACTGCAGAGGCGAGGGTGGG + Intronic
1050039731 9:1476514-1476536 TTCATTGCAGAAGACAGTGTTGG - Intergenic
1051179555 9:14395941-14395963 GGCACTGCAGCTGTCAGTGTTGG + Intronic
1052832044 9:33223562-33223584 GCCACTGCAGAGGTCAGAGGAGG - Intronic
1053430223 9:38037354-38037376 GTGACTGGAGCGGGCAGTGGTGG - Intronic
1053444440 9:38140876-38140898 GTCACTGTGAAAGGCAGTGTGGG + Intergenic
1055038818 9:71846885-71846907 GTAAATGGAGAGGGCAGAGTAGG + Intergenic
1055082148 9:72277960-72277982 GTTACTGCCATGGGCAGTGTGGG + Intergenic
1055885961 9:81063476-81063498 GGCAGTGCAGAGGGAAATGTGGG + Intergenic
1057481427 9:95448028-95448050 GTCACTGCGGAGGGCTGTGGCGG + Intronic
1059435044 9:114270953-114270975 GGTAGTGCAGAGGGCAGGGTGGG - Intronic
1060730507 9:126034007-126034029 GTCACTGCAGAGGGCTGGGGTGG + Intergenic
1061240144 9:129365388-129365410 ATCACGGCAGAGGACAATGTTGG + Intergenic
1062197201 9:135280938-135280960 GTCACTGCAGAGAGCTCGGTTGG - Intergenic
1062231791 9:135485999-135486021 GCCCCTGTAGAGGGCAGTGACGG + Exonic
1062309503 9:135928499-135928521 GCCACTGCCGAGGGCCGTGGTGG - Intergenic
1062599689 9:137314276-137314298 GCCACAGCAGGGGACAGTGTCGG - Intronic
1203751484 Un_GL000218v1:84425-84447 GACACTGGACAGGGCAATGTGGG - Intergenic
1203482509 Un_GL000224v1:19931-19953 GACACTGGACAGGGCGGTGTGGG + Intergenic
1187094211 X:16129463-16129485 GTCATTGCAGAGGGCTCTATTGG + Intronic
1187134462 X:16533376-16533398 GACACTCCAGCGGGCAATGTTGG + Intergenic
1189115686 X:38340051-38340073 GTCAAATCAAAGGGCAGTGTTGG + Intronic
1193642532 X:84028855-84028877 GCCACTGCAGTGGGCAGGGTTGG - Intergenic
1193820070 X:86149832-86149854 TTATCTGCAGAGGGCAATGTGGG + Intronic
1195012337 X:100744956-100744978 CTCAATGCAAAGGGCAGTTTGGG + Intergenic
1195753720 X:108180737-108180759 GCTGCTGGAGAGGGCAGTGTGGG - Intronic
1196893327 X:120310618-120310640 GCCGCTGCAGAGGGCAGGGCTGG + Intronic
1197341045 X:125266645-125266667 GGCAGTGCAGAGGGAAATGTGGG + Intergenic
1198032789 X:132769843-132769865 GTTGCTGCAGAAGACAGTGTTGG - Intronic
1199713864 X:150492014-150492036 GTCACTGTTGAGGACAGTGGGGG + Intronic
1200056910 X:153466381-153466403 GTCACAGCAGAGGGCAGAGCAGG + Intronic
1200079069 X:153566603-153566625 CCCACTGCAGAGGGTGGTGTTGG - Intronic
1200215400 X:154365991-154366013 GCCACAGCAGAGGGCAGTCAGGG + Intronic
1200445477 Y:3256137-3256159 GGCACTGCAAAGGGAAATGTGGG - Intergenic
1201165138 Y:11202039-11202061 GACACTGGACAGGGCAGTGTGGG - Intergenic