ID: 967895246

View in Genome Browser
Species Human (GRCh38)
Location 3:194390111-194390133
Sequence TACTCAATGGAACCCCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967895242_967895246 2 Left 967895242 3:194390086-194390108 CCAGTGTGAGCAGAGAGATCCCG No data
Right 967895246 3:194390111-194390133 TACTCAATGGAACCCCAGAGAGG No data
967895241_967895246 8 Left 967895241 3:194390080-194390102 CCACAGCCAGTGTGAGCAGAGAG No data
Right 967895246 3:194390111-194390133 TACTCAATGGAACCCCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967895246 Original CRISPR TACTCAATGGAACCCCAGAG AGG Intergenic
No off target data available for this crispr