ID: 967896068

View in Genome Browser
Species Human (GRCh38)
Location 3:194397047-194397069
Sequence ACGTGTTTGGGGCTCTGCCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 105}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967896068_967896080 27 Left 967896068 3:194397047-194397069 CCGGGGCAGAGCCCCAAACACGT 0: 1
1: 0
2: 2
3: 6
4: 105
Right 967896080 3:194397097-194397119 GGTCGAGCTGGACGCTCTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 76
967896068_967896077 6 Left 967896068 3:194397047-194397069 CCGGGGCAGAGCCCCAAACACGT 0: 1
1: 0
2: 2
3: 6
4: 105
Right 967896077 3:194397076-194397098 GCAGGGTCTCCAGCTGGTTGTGG 0: 1
1: 0
2: 2
3: 20
4: 236
967896068_967896075 0 Left 967896068 3:194397047-194397069 CCGGGGCAGAGCCCCAAACACGT 0: 1
1: 0
2: 2
3: 6
4: 105
Right 967896075 3:194397070-194397092 CGCCAGGCAGGGTCTCCAGCTGG 0: 1
1: 0
2: 1
3: 31
4: 243
967896068_967896079 15 Left 967896068 3:194397047-194397069 CCGGGGCAGAGCCCCAAACACGT 0: 1
1: 0
2: 2
3: 6
4: 105
Right 967896079 3:194397085-194397107 CCAGCTGGTTGTGGTCGAGCTGG 0: 1
1: 0
2: 0
3: 12
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967896068 Original CRISPR ACGTGTTTGGGGCTCTGCCC CGG (reversed) Exonic