ID: 967896068

View in Genome Browser
Species Human (GRCh38)
Location 3:194397047-194397069
Sequence ACGTGTTTGGGGCTCTGCCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 105}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967896068_967896079 15 Left 967896068 3:194397047-194397069 CCGGGGCAGAGCCCCAAACACGT 0: 1
1: 0
2: 2
3: 6
4: 105
Right 967896079 3:194397085-194397107 CCAGCTGGTTGTGGTCGAGCTGG 0: 1
1: 0
2: 0
3: 12
4: 185
967896068_967896080 27 Left 967896068 3:194397047-194397069 CCGGGGCAGAGCCCCAAACACGT 0: 1
1: 0
2: 2
3: 6
4: 105
Right 967896080 3:194397097-194397119 GGTCGAGCTGGACGCTCTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 76
967896068_967896077 6 Left 967896068 3:194397047-194397069 CCGGGGCAGAGCCCCAAACACGT 0: 1
1: 0
2: 2
3: 6
4: 105
Right 967896077 3:194397076-194397098 GCAGGGTCTCCAGCTGGTTGTGG 0: 1
1: 0
2: 2
3: 20
4: 236
967896068_967896075 0 Left 967896068 3:194397047-194397069 CCGGGGCAGAGCCCCAAACACGT 0: 1
1: 0
2: 2
3: 6
4: 105
Right 967896075 3:194397070-194397092 CGCCAGGCAGGGTCTCCAGCTGG 0: 1
1: 0
2: 1
3: 31
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967896068 Original CRISPR ACGTGTTTGGGGCTCTGCCC CGG (reversed) Exonic
900089804 1:915083-915105 CCCTGCTTGGTGCTCTGCCCAGG - Intergenic
900093333 1:930013-930035 CCGTGCTTGGGGCTCGGCCTGGG + Intronic
900164391 1:1238943-1238965 ATCTGTGTGGGTCTCTGCCCTGG - Intergenic
900488511 1:2934936-2934958 GCGTGTTTTGGGCCCTGCTCTGG + Intergenic
900646509 1:3711207-3711229 ACGTGTGTGGAGCGCTCCCCAGG - Intronic
901622857 1:10602959-10602981 GAGTGTTTGGGGCTAGGCCCAGG - Intronic
901942956 1:12677808-12677830 AAGTGTTTGGACCTCTCCCCTGG - Intergenic
905002606 1:34684912-34684934 AAGTGTTTGGGGCTCAGGCTGGG + Intergenic
916142347 1:161710930-161710952 AGGGGTTTGGGGCACTGCTCAGG - Intronic
917012210 1:170487670-170487692 AGGTGTTTGGGGCTCTGTGCAGG + Intergenic
920165530 1:204032989-204033011 ACTTGTTTGGCACTCAGCCCAGG - Intergenic
920201740 1:204263680-204263702 ACGTGTCTGTGTCTCTGCACAGG + Intronic
1063036467 10:2290853-2290875 CAGTGTTGGGGGCACTGCCCCGG - Intergenic
1067755612 10:49002050-49002072 GCATGGTTGGGGCTCTGCCAGGG - Intergenic
1069809630 10:71148791-71148813 CCATGTTTGGAGCCCTGCCCAGG - Intergenic
1077304998 11:1865002-1865024 ACTTCCTTGGCGCTCTGCCCTGG - Intronic
1077331438 11:1985532-1985554 ACGGGTTCCAGGCTCTGCCCGGG - Intergenic
1078107678 11:8368795-8368817 AGGTGGTTGGGGCCCTCCCCGGG - Intergenic
1084519318 11:69654055-69654077 ACGTGGTTGGGGCCCTGCCCTGG + Exonic
1084614424 11:70226340-70226362 ACTTCTTTAGGGCCCTGCCCTGG - Intergenic
1085158882 11:74322778-74322800 TCTCTTTTGGGGCTCTGCCCAGG + Intergenic
1091234860 11:134014626-134014648 AGGTGTTTGGGGCTTTGCAGGGG - Intergenic
1202814419 11_KI270721v1_random:40708-40730 ACGGGTTCCAGGCTCTGCCCGGG - Intergenic
1093088729 12:14896113-14896135 ACTTGTTTGGTGCTCTACCCGGG - Intronic
1096614198 12:52822513-52822535 ATGTGTATAGGGCTGTGCCCAGG + Intronic
1098445079 12:70558154-70558176 AAGTGTTTAGAGTTCTGCCCTGG + Intronic
1102812678 12:115837977-115837999 ACATGTGGGGGGCGCTGCCCAGG - Intergenic
1104723889 12:131063578-131063600 ACTTGTGTGGGGCTGTTCCCAGG + Intronic
1104930368 12:132336272-132336294 ATGGGGCTGGGGCTCTGCCCGGG + Intergenic
1113418985 13:110155233-110155255 GCGTGAGTGGGGCTCTTCCCGGG + Intronic
1113505668 13:110814003-110814025 GCGTGCTGGGGGCGCTGCCCGGG + Intergenic
1121689227 14:95863991-95864013 ACTTGTTTTCAGCTCTGCCCAGG - Intergenic
1122634805 14:103124842-103124864 AGGAGTGTGGGACTCTGCCCAGG + Intronic
1126608333 15:50503317-50503339 TCCTGTTTAGGGCTCCGCCCAGG - Exonic
1126859475 15:52870195-52870217 ACGCTTTTGGAGCCCTGCCCAGG - Intergenic
1128389920 15:67175806-67175828 ACTGGGTTGGGCCTCTGCCCTGG - Intronic
1128603326 15:69015933-69015955 AAGTGTGTGGGGCTGGGCCCAGG + Intronic
1130863113 15:87908700-87908722 AAATGTTTGAGGCCCTGCCCAGG - Intronic
1132549875 16:549975-549997 AGGTGATTGGGGCTGTGGCCTGG - Intronic
1133171580 16:3985478-3985500 ACGTGCGTGGGCCTCTGCCAAGG - Intronic
1133219678 16:4314691-4314713 ACGTGCTTCGGGCTCTGGCGGGG + Intergenic
1135140084 16:19913771-19913793 GCGTGTTTGAGGCTCTCGCCTGG + Intergenic
1140717386 16:77739065-77739087 ACATTGTTGGGGCTCTGTCCAGG + Intronic
1140733669 16:77878755-77878777 AGGGGCTTGGGGCTCTGACCTGG - Intronic
1144770562 17:17757201-17757223 AGGTGTTGGGTGCTCAGCCCTGG + Intronic
1145282278 17:21476864-21476886 TGGTGTTTGGGGCTTTACCCTGG - Intergenic
1145395160 17:22488737-22488759 TGGTGTTTGGGGCTTTACCCTGG + Intergenic
1149528611 17:57377439-57377461 GGGAATTTGGGGCTCTGCCCAGG + Intronic
1151976073 17:77484118-77484140 ACCTGTTGGGGACCCTGCCCGGG - Intronic
1152519281 17:80845873-80845895 GCTGGTTTGTGGCTCTGCCCTGG + Intronic
1156454067 18:37282997-37283019 ACGTGTTTGGGGGCCTGCAATGG + Intronic
1159037119 18:63287950-63287972 AAGAGTTTGGGGCTCTGTCTGGG + Intronic
1162095899 19:8309784-8309806 AAGGGTCTGGGGCTGTGCCCTGG + Intronic
1164506143 19:28863107-28863129 ACGTGAATGGGGCACTGCCCTGG - Intergenic
1164982446 19:32624505-32624527 ACGTGTGTGGGGCTCAGGCCTGG - Intronic
1166680767 19:44765260-44765282 ACGTGATTGAGGCCCTACCCAGG + Intergenic
1166765569 19:45251039-45251061 GCGTCTCTGGCGCTCTGCCCCGG + Intronic
926350074 2:11986230-11986252 ATGTGTGTGGGGCTCAGCCAAGG + Intergenic
932456776 2:71854418-71854440 ACGTGCTTTGGGCTATGCCCTGG + Intergenic
939062154 2:137435284-137435306 ATGTGTTAGGCACTCTGCCCAGG + Intronic
939561444 2:143737066-143737088 ACTTGTTTGGGACTCTCTCCTGG + Intronic
940732971 2:157415767-157415789 GCATGTTTGGGACCCTGCCCCGG - Exonic
946146823 2:217737518-217737540 TCCTGTCTGGGCCTCTGCCCAGG + Intronic
946970605 2:225086783-225086805 AGGTGTTTGCCGCTCTGCTCTGG - Intergenic
947269143 2:228314131-228314153 ACCTTGTGGGGGCTCTGCCCAGG - Intergenic
948368320 2:237472900-237472922 GCGAGTTGGGGGCCCTGCCCTGG - Intergenic
948739026 2:240030888-240030910 CCCAGTTTGGGGTTCTGCCCTGG - Intergenic
1171750290 20:29042744-29042766 ACGAGTTTGGGCCACAGCCCAGG - Intergenic
1172818404 20:37709635-37709657 ACGTAATGGGGGCTCTGGCCAGG + Intronic
1180246770 21:46553742-46553764 ACGTGTTTCTGGCTCTGCCCTGG + Intronic
1184021134 22:41822218-41822240 AGGAGTTTGGGGCTCTATCCTGG + Intronic
1185217538 22:49610148-49610170 TCATTTATGGGGCTCTGCCCTGG - Intronic
950794707 3:15501463-15501485 ACCTGTTTGGGGCAGTGCCAAGG + Intronic
953381601 3:42476650-42476672 ACGTGGTGGGTGTTCTGCCCTGG - Intergenic
958714594 3:97764449-97764471 GCGTGTTTGTCGCTCGGCCCTGG - Intergenic
962364010 3:134765442-134765464 ATGTGTTGGGGCCCCTGCCCTGG - Intronic
964824682 3:160812131-160812153 ATGTCTTTGGGCCTCTGCACTGG + Intronic
967841583 3:194009178-194009200 ACGTAATTGCGGCCCTGCCCTGG - Intergenic
967896068 3:194397047-194397069 ACGTGTTTGGGGCTCTGCCCCGG - Exonic
968088440 3:195885199-195885221 TCATGTTTGGGGGTGTGCCCTGG - Intronic
969484574 4:7464993-7465015 AAGTGCTGGGGGTTCTGCCCAGG + Intronic
977765804 4:100796399-100796421 AGCAGTTTTGGGCTCTGCCCTGG - Intronic
980966178 4:139523258-139523280 ACCTCTTTGGCTCTCTGCCCAGG - Intronic
985479873 5:102836-102858 ACGGATTTGGGGCCCTGCCTGGG + Intergenic
985937701 5:3109479-3109501 GCCTGTTTGTGGCTCTGCCAGGG + Intergenic
988772999 5:34450525-34450547 AAGTGTTTGGAGTTCTCCCCTGG - Intergenic
997741276 5:136257086-136257108 ACTTGTCTGGGACTATGCCCAGG + Intronic
998469475 5:142372261-142372283 CTGTGTGTGAGGCTCTGCCCTGG + Intergenic
1003184575 6:3819925-3819947 ACGTGTCTGGGGGTCAGCCGTGG - Intergenic
1004466396 6:15889259-15889281 ATGTGTTTGGTGCTCTTCTCTGG - Intergenic
1010255109 6:73748626-73748648 TTGTGTTTGGGCCTCAGCCCTGG + Intronic
1012834793 6:104251789-104251811 ACATCTTAGGAGCTCTGCCCTGG - Intergenic
1018714514 6:166521342-166521364 ACGAGTTGGCGGTTCTGCCCCGG - Intronic
1019357435 7:587963-587985 ACTTGTGTGGGGCTCAGGCCGGG + Intronic
1021755626 7:23848967-23848989 TAGTGTTGGGGGTTCTGCCCAGG + Intergenic
1023862106 7:44222889-44222911 ATGTGTGTGGGGCACTGCCTGGG + Intronic
1034721405 7:153297309-153297331 ACGTGTTTTGATTTCTGCCCAGG - Intergenic
1036709168 8:11067350-11067372 CCGGGTGGGGGGCTCTGCCCAGG - Intronic
1041495043 8:58476902-58476924 AGGTCTTTGGGGCTTTGCCTTGG + Intergenic
1042667214 8:71220417-71220439 CTGTGTTTGGGGATCTGGCCTGG + Intronic
1047151172 8:122264794-122264816 AAGTGTTTGGAGTTCTCCCCTGG + Intergenic
1051268933 9:15335926-15335948 ACGTGTTAGGGCCTATCCCCAGG - Intergenic
1053721373 9:40950435-40950457 ACGGGTTTGGGCCACAGCCCAGG - Intergenic
1053931904 9:43119514-43119536 AAGTGAGTGGGGCTCTGCCATGG - Intergenic
1054344625 9:63901733-63901755 ACGGGTTTGGGCCACAGCCCAGG + Intergenic
1056968489 9:91183735-91183757 ACCTGGGTGGGGCTCTGGCCGGG + Intergenic
1058064812 9:100537475-100537497 GCATGTTTGGGGCTCAGCCCAGG + Intronic
1058177951 9:101760014-101760036 ACGTGTTTTTGGCTCTCCCTGGG + Intergenic
1059017921 9:110542238-110542260 AAGTGTCTGGGGTTCTTCCCGGG + Intronic
1061869119 9:133510944-133510966 ACATCTTGGGGGCTCTGACCAGG - Intergenic
1062331795 9:136048151-136048173 GCCTGTCTGGGGTTCTGCCCTGG + Intronic
1062373909 9:136253577-136253599 CAGTAGTTGGGGCTCTGCCCAGG - Intergenic
1062475400 9:136724239-136724261 CTGTGTTTGGGGAACTGCCCTGG - Intergenic
1203453816 Un_GL000219v1:145712-145734 ACGGGTTTGGGCCACAGCCCAGG + Intergenic