ID: 967896075

View in Genome Browser
Species Human (GRCh38)
Location 3:194397070-194397092
Sequence CGCCAGGCAGGGTCTCCAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 243}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967896067_967896075 7 Left 967896067 3:194397040-194397062 CCGTCAGCCGGGGCAGAGCCCCA 0: 1
1: 0
2: 0
3: 21
4: 218
Right 967896075 3:194397070-194397092 CGCCAGGCAGGGTCTCCAGCTGG 0: 1
1: 0
2: 1
3: 31
4: 243
967896068_967896075 0 Left 967896068 3:194397047-194397069 CCGGGGCAGAGCCCCAAACACGT 0: 1
1: 0
2: 2
3: 6
4: 105
Right 967896075 3:194397070-194397092 CGCCAGGCAGGGTCTCCAGCTGG 0: 1
1: 0
2: 1
3: 31
4: 243
967896060_967896075 21 Left 967896060 3:194397026-194397048 CCCCAACAGGACCTCCGTCAGCC 0: 1
1: 0
2: 0
3: 7
4: 84
Right 967896075 3:194397070-194397092 CGCCAGGCAGGGTCTCCAGCTGG 0: 1
1: 0
2: 1
3: 31
4: 243
967896061_967896075 20 Left 967896061 3:194397027-194397049 CCCAACAGGACCTCCGTCAGCCG 0: 1
1: 0
2: 0
3: 3
4: 44
Right 967896075 3:194397070-194397092 CGCCAGGCAGGGTCTCCAGCTGG 0: 1
1: 0
2: 1
3: 31
4: 243
967896062_967896075 19 Left 967896062 3:194397028-194397050 CCAACAGGACCTCCGTCAGCCGG 0: 1
1: 0
2: 0
3: 2
4: 91
Right 967896075 3:194397070-194397092 CGCCAGGCAGGGTCTCCAGCTGG 0: 1
1: 0
2: 1
3: 31
4: 243
967896066_967896075 10 Left 967896066 3:194397037-194397059 CCTCCGTCAGCCGGGGCAGAGCC 0: 1
1: 0
2: 1
3: 11
4: 177
Right 967896075 3:194397070-194397092 CGCCAGGCAGGGTCTCCAGCTGG 0: 1
1: 0
2: 1
3: 31
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967896075 Original CRISPR CGCCAGGCAGGGTCTCCAGC TGG Exonic