ID: 967896077

View in Genome Browser
Species Human (GRCh38)
Location 3:194397076-194397098
Sequence GCAGGGTCTCCAGCTGGTTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 236}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967896074_967896077 -7 Left 967896074 3:194397060-194397082 CCAAACACGTCGCCAGGCAGGGT 0: 1
1: 0
2: 2
3: 3
4: 94
Right 967896077 3:194397076-194397098 GCAGGGTCTCCAGCTGGTTGTGG 0: 1
1: 0
2: 2
3: 20
4: 236
967896066_967896077 16 Left 967896066 3:194397037-194397059 CCTCCGTCAGCCGGGGCAGAGCC 0: 1
1: 0
2: 1
3: 11
4: 177
Right 967896077 3:194397076-194397098 GCAGGGTCTCCAGCTGGTTGTGG 0: 1
1: 0
2: 2
3: 20
4: 236
967896072_967896077 -6 Left 967896072 3:194397059-194397081 CCCAAACACGTCGCCAGGCAGGG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 967896077 3:194397076-194397098 GCAGGGTCTCCAGCTGGTTGTGG 0: 1
1: 0
2: 2
3: 20
4: 236
967896068_967896077 6 Left 967896068 3:194397047-194397069 CCGGGGCAGAGCCCCAAACACGT 0: 1
1: 0
2: 2
3: 6
4: 105
Right 967896077 3:194397076-194397098 GCAGGGTCTCCAGCTGGTTGTGG 0: 1
1: 0
2: 2
3: 20
4: 236
967896067_967896077 13 Left 967896067 3:194397040-194397062 CCGTCAGCCGGGGCAGAGCCCCA 0: 1
1: 0
2: 0
3: 21
4: 218
Right 967896077 3:194397076-194397098 GCAGGGTCTCCAGCTGGTTGTGG 0: 1
1: 0
2: 2
3: 20
4: 236
967896061_967896077 26 Left 967896061 3:194397027-194397049 CCCAACAGGACCTCCGTCAGCCG 0: 1
1: 0
2: 0
3: 3
4: 44
Right 967896077 3:194397076-194397098 GCAGGGTCTCCAGCTGGTTGTGG 0: 1
1: 0
2: 2
3: 20
4: 236
967896060_967896077 27 Left 967896060 3:194397026-194397048 CCCCAACAGGACCTCCGTCAGCC 0: 1
1: 0
2: 0
3: 7
4: 84
Right 967896077 3:194397076-194397098 GCAGGGTCTCCAGCTGGTTGTGG 0: 1
1: 0
2: 2
3: 20
4: 236
967896070_967896077 -5 Left 967896070 3:194397058-194397080 CCCCAAACACGTCGCCAGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 86
Right 967896077 3:194397076-194397098 GCAGGGTCTCCAGCTGGTTGTGG 0: 1
1: 0
2: 2
3: 20
4: 236
967896062_967896077 25 Left 967896062 3:194397028-194397050 CCAACAGGACCTCCGTCAGCCGG 0: 1
1: 0
2: 0
3: 2
4: 91
Right 967896077 3:194397076-194397098 GCAGGGTCTCCAGCTGGTTGTGG 0: 1
1: 0
2: 2
3: 20
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967896077 Original CRISPR GCAGGGTCTCCAGCTGGTTG TGG Exonic