ID: 967896079

View in Genome Browser
Species Human (GRCh38)
Location 3:194397085-194397107
Sequence CCAGCTGGTTGTGGTCGAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 185}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967896066_967896079 25 Left 967896066 3:194397037-194397059 CCTCCGTCAGCCGGGGCAGAGCC 0: 1
1: 0
2: 1
3: 11
4: 177
Right 967896079 3:194397085-194397107 CCAGCTGGTTGTGGTCGAGCTGG 0: 1
1: 0
2: 0
3: 12
4: 185
967896070_967896079 4 Left 967896070 3:194397058-194397080 CCCCAAACACGTCGCCAGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 86
Right 967896079 3:194397085-194397107 CCAGCTGGTTGTGGTCGAGCTGG 0: 1
1: 0
2: 0
3: 12
4: 185
967896076_967896079 -10 Left 967896076 3:194397072-194397094 CCAGGCAGGGTCTCCAGCTGGTT 0: 1
1: 0
2: 1
3: 33
4: 214
Right 967896079 3:194397085-194397107 CCAGCTGGTTGTGGTCGAGCTGG 0: 1
1: 0
2: 0
3: 12
4: 185
967896072_967896079 3 Left 967896072 3:194397059-194397081 CCCAAACACGTCGCCAGGCAGGG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 967896079 3:194397085-194397107 CCAGCTGGTTGTGGTCGAGCTGG 0: 1
1: 0
2: 0
3: 12
4: 185
967896067_967896079 22 Left 967896067 3:194397040-194397062 CCGTCAGCCGGGGCAGAGCCCCA 0: 1
1: 0
2: 0
3: 21
4: 218
Right 967896079 3:194397085-194397107 CCAGCTGGTTGTGGTCGAGCTGG 0: 1
1: 0
2: 0
3: 12
4: 185
967896068_967896079 15 Left 967896068 3:194397047-194397069 CCGGGGCAGAGCCCCAAACACGT 0: 1
1: 0
2: 2
3: 6
4: 105
Right 967896079 3:194397085-194397107 CCAGCTGGTTGTGGTCGAGCTGG 0: 1
1: 0
2: 0
3: 12
4: 185
967896074_967896079 2 Left 967896074 3:194397060-194397082 CCAAACACGTCGCCAGGCAGGGT 0: 1
1: 0
2: 2
3: 3
4: 94
Right 967896079 3:194397085-194397107 CCAGCTGGTTGTGGTCGAGCTGG 0: 1
1: 0
2: 0
3: 12
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967896079 Original CRISPR CCAGCTGGTTGTGGTCGAGC TGG Exonic