ID: 967896080

View in Genome Browser
Species Human (GRCh38)
Location 3:194397097-194397119
Sequence GGTCGAGCTGGACGCTCTCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 76}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967896068_967896080 27 Left 967896068 3:194397047-194397069 CCGGGGCAGAGCCCCAAACACGT 0: 1
1: 0
2: 2
3: 6
4: 105
Right 967896080 3:194397097-194397119 GGTCGAGCTGGACGCTCTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 76
967896072_967896080 15 Left 967896072 3:194397059-194397081 CCCAAACACGTCGCCAGGCAGGG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 967896080 3:194397097-194397119 GGTCGAGCTGGACGCTCTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 76
967896074_967896080 14 Left 967896074 3:194397060-194397082 CCAAACACGTCGCCAGGCAGGGT 0: 1
1: 0
2: 2
3: 3
4: 94
Right 967896080 3:194397097-194397119 GGTCGAGCTGGACGCTCTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 76
967896076_967896080 2 Left 967896076 3:194397072-194397094 CCAGGCAGGGTCTCCAGCTGGTT 0: 1
1: 0
2: 1
3: 33
4: 214
Right 967896080 3:194397097-194397119 GGTCGAGCTGGACGCTCTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 76
967896070_967896080 16 Left 967896070 3:194397058-194397080 CCCCAAACACGTCGCCAGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 86
Right 967896080 3:194397097-194397119 GGTCGAGCTGGACGCTCTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967896080 Original CRISPR GGTCGAGCTGGACGCTCTCC AGG Exonic