ID: 967896689

View in Genome Browser
Species Human (GRCh38)
Location 3:194401204-194401226
Sequence CCTTTTTTATGGTGTCTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 237}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967896689 Original CRISPR CCTTTTTTATGGTGTCTTGA AGG (reversed) Intergenic
900722676 1:4187519-4187541 CCTCTTTTTTGGTGTGGTGAGGG + Intergenic
901557975 1:10046604-10046626 CCTTGATTCTGGTCTCTTGAAGG + Intronic
904395429 1:30217969-30217991 AATTTTTAATGGTGTCTTCAAGG - Intergenic
904905173 1:33892078-33892100 TTTTTTTGATGGTGTCTTTAGGG - Intronic
907954055 1:59211592-59211614 CCTTATTTATCCCGTCTTGAAGG - Intergenic
909203055 1:72716702-72716724 CTTTTGTTATTGTGTCTTCAGGG - Intergenic
910025946 1:82652666-82652688 CATTTTTTAAGGTGTCTTTATGG + Intergenic
910538309 1:88325271-88325293 CTTTTTTTATGCTGAATTGAAGG + Intergenic
913326873 1:117635251-117635273 CCTTTGTTCTGGTGTCCTGAGGG + Intergenic
913339151 1:117740335-117740357 TCTGATTTATGGTGACTTGATGG + Intergenic
913599929 1:120413394-120413416 GCTTTTTTCTTGTTTCTTGATGG + Intergenic
914087129 1:144463269-144463291 GCTTTTTTCTTGTTTCTTGAGGG - Intergenic
914311479 1:146470933-146470955 GCTTTTTTCTTGTTTCTTGACGG + Intergenic
914590937 1:149105165-149105187 GCTTTTTTCTTGTTTCTTGAGGG - Intergenic
921489362 1:215755566-215755588 TCTTTTTCCTGGTGTCTAGAAGG - Intronic
921970634 1:221145057-221145079 CTTGATTTATGGTTTCTTGAGGG - Intergenic
922053025 1:222012685-222012707 CCATTTTTATTGTGTGTTGAGGG + Intergenic
923341027 1:233007259-233007281 CCATTTGTATGGTGACTTGTGGG + Intronic
1063562021 10:7137434-7137456 AATTCTTTATGGCGTCTTGATGG + Intergenic
1064711667 10:18133395-18133417 CATTTTTCATGGTGGCTTTAGGG - Intergenic
1065913743 10:30334145-30334167 CCTTTTTTGTAGTATCTTGCAGG - Intronic
1068486823 10:57669185-57669207 ACTTTTGTGTGGTTTCTTGAGGG + Intergenic
1068632362 10:59311085-59311107 AGTTTTTCATGGTGTTTTGAGGG - Intronic
1068816788 10:61324816-61324838 CCTTTTGCAGGGTTTCTTGATGG + Intergenic
1069012305 10:63387459-63387481 CCTTTTTTATGCTGTCTCTTTGG - Intronic
1069415615 10:68198172-68198194 CTTTTCATATGGTGTCTGGAAGG + Intronic
1070033197 10:72696906-72696928 ACTTCTTTATGGTGGATTGATGG + Intronic
1070477362 10:76843121-76843143 TCTTTTTTATTGAGTGTTGAGGG + Intergenic
1071081266 10:81814785-81814807 ACTTTTTTAGAGTGTCTTAAAGG - Intergenic
1071989179 10:91083599-91083621 CCATTTATATGTTGTCTTTATGG - Intergenic
1072507941 10:96088730-96088752 CTTTTTGTATGGTTTCTTGCAGG - Intergenic
1072551349 10:96479911-96479933 ACTTGTGTGTGGTGTCTTGAAGG - Intronic
1072646585 10:97260228-97260250 CCTGATTTATAGTTTCTTGATGG - Intronic
1074013100 10:109504480-109504502 CCTTTGTCATGATGTCTTCAAGG - Intergenic
1074152985 10:110774950-110774972 CCTTATTTATGGTATTTTGGTGG - Intronic
1076528849 10:131130922-131130944 CCATATTTATGGTGTCATTAGGG - Intronic
1078740143 11:14058976-14058998 TCTTTTATAAAGTGTCTTGAGGG + Intronic
1079776850 11:24542407-24542429 CCCTTTTTCTTGTGTCTTAAGGG - Intronic
1081082839 11:38764711-38764733 CCCTTTTTATTTTGTCTTAATGG - Intergenic
1081865614 11:46358124-46358146 CCTTTTTTTTGCTGTGCTGATGG + Intronic
1086602577 11:88652700-88652722 ACTATTTTATGGTTTATTGATGG + Intronic
1086758347 11:90594012-90594034 TCTTTTTCATTTTGTCTTGAGGG + Intergenic
1087730247 11:101770162-101770184 CCTCCTTTATGGTGACTTCATGG + Intronic
1087780350 11:102295020-102295042 TCTTTTTCATGGTGGCTCGAAGG + Intergenic
1088531551 11:110816270-110816292 ACATTTTTATGGTGATTTGAGGG - Intergenic
1089448758 11:118575295-118575317 TCTTTTTAATTGTGTTTTGAGGG + Intronic
1091190359 11:133689195-133689217 CTCTTTTTCTGGTGTCTTAAGGG - Intergenic
1091242731 11:134064743-134064765 CCTTTTCTTTGGTGTCTGCAGGG + Intergenic
1092426654 12:8380864-8380886 TCTTTTCTATGTTGTCCTGATGG - Intergenic
1092679506 12:10962378-10962400 TCTTTTATATGCTGTTTTGAAGG + Intronic
1094107534 12:26830341-26830363 CTTTTTTGTTGGTGTTTTGAAGG - Intronic
1094122370 12:26987780-26987802 CCTTTTTTTAAGTGTCTTTAGGG - Intronic
1094759099 12:33508825-33508847 AGTTTTTGATGGAGTCTTGAGGG - Intergenic
1100920765 12:99483677-99483699 GCTTGTTTTTGGTGTCTTTATGG + Intronic
1103128977 12:118450336-118450358 TCCCTTTTATGGAGTCTTGAAGG + Intergenic
1103229020 12:119312327-119312349 CTCTTTTTATGGTGTCTTTCCGG - Intergenic
1103332115 12:120161558-120161580 CCTTTTTTATGCTGTCCTGCTGG + Exonic
1103351162 12:120284696-120284718 GCTTTATTCTGGTGTCATGAAGG - Intergenic
1104668398 12:130663796-130663818 CCATTTTTATGTTGTCTTGAGGG - Intronic
1110358637 13:74599121-74599143 CTTCCTTTAGGGTGTCTTGATGG - Intergenic
1110510167 13:76341369-76341391 CATGTTTCATGGTGTATTGAGGG - Intergenic
1110735448 13:78930365-78930387 CCTTATTTATGGTGTACTGGGGG + Intergenic
1110825966 13:79972610-79972632 CATTTTGTATAGTGTCTTGCAGG + Intergenic
1112940131 13:104851882-104851904 CCATTTTTATGTTGATTTGATGG + Intergenic
1113396748 13:109954960-109954982 GCTATTTTAGGGTGACTTGAGGG + Intergenic
1114332097 14:21647291-21647313 CCATTTTTATGCAGTCTTAATGG - Intergenic
1115834289 14:37380501-37380523 CAGTCTTTATTGTGTCTTGATGG - Intronic
1116274613 14:42815631-42815653 CCTTTTTTATTGTTCCTAGAGGG + Intergenic
1118689222 14:68322209-68322231 ACTTCTGTATGGTATCTTGAAGG + Intronic
1121069975 14:91009824-91009846 CCTTTCCTGTGGTCTCTTGAAGG - Intronic
1125037307 15:35140629-35140651 CGTTTTTCATAGTGTCTGGAAGG - Intergenic
1126861541 15:52888410-52888432 AGTTTTTTATGGAGTCTTTAGGG - Intergenic
1127875739 15:63109865-63109887 CATCTTTTATGGTTGCTTGATGG - Intergenic
1128029005 15:64462640-64462662 CCTTTTTAATGGTGGCTTCCTGG + Intronic
1128249501 15:66154542-66154564 TCTTTATGATGGTGTGTTGAAGG - Intronic
1128597805 15:68967568-68967590 CATCTTTTATGGTATCTTGCAGG + Intronic
1129633040 15:77282899-77282921 ACTTTTTAATGGTGCCTTAAAGG - Intronic
1130749429 15:86694487-86694509 GCTTTTTGATGGAGTCTTTAGGG + Intronic
1130757035 15:86774924-86774946 ACTTTTCTATGGTGACTTAAAGG - Intronic
1136918667 16:34242216-34242238 CTCTTTTTGTGGTGTCTGGAAGG + Intergenic
1137834086 16:51573987-51574009 CCTATTTTATGCTGTCTTTTTGG - Intergenic
1138297344 16:55898486-55898508 CCTTTTTAAAGGTCTCTTCAGGG - Intronic
1138830676 16:60370639-60370661 CCTGTTTTATGATGATTTGAAGG - Intergenic
1140452426 16:75081453-75081475 CCTTTGTTTTTGTTTCTTGAGGG + Intronic
1142782902 17:2195198-2195220 CCCTTTTTATGATGTCATGAGGG - Intronic
1143967859 17:10769772-10769794 GTTTCTTTCTGGTGTCTTGATGG + Intergenic
1144269693 17:13603679-13603701 CCATTTTTAAGTTGTTTTGAAGG + Intergenic
1149060433 17:52415065-52415087 ACTTTTGAATGGGGTCTTGAAGG + Intergenic
1150231473 17:63554244-63554266 CTTTTGTTGTGGTCTCTTGAGGG + Intronic
1155324761 18:24654684-24654706 CCTTTTTTAGTGTGTTTTTAAGG - Intergenic
1155762205 18:29582515-29582537 CATTTTTTATGGATTCTTGAAGG - Intergenic
1158142309 18:54268993-54269015 CCTTTTTTTTTTTTTCTTGAAGG - Intergenic
1162243184 19:9374748-9374770 ATTTTTTCATGGTGTCTTTAGGG + Intronic
1163193744 19:15698939-15698961 ACTTTTGTATGTTGTCATGATGG - Intergenic
1164498434 19:28792043-28792065 TCTTTTTTATGTTGTCTTCCAGG + Intergenic
1166263051 19:41656296-41656318 GCTTTTTGAAGGAGTCTTGATGG - Intronic
1168274546 19:55270097-55270119 CCTTTTTTTTGGTGGCTGCAGGG - Intronic
925955526 2:8960466-8960488 GCTCTTCTGTGGTGTCTTGAAGG - Intronic
928666440 2:33554779-33554801 TCTTCTTTATGGTGTTTAGAAGG + Intronic
929606152 2:43235600-43235622 CTTTTTTTATGGTCTCCTTAAGG + Intronic
930212745 2:48659173-48659195 GATTTTGTATAGTGTCTTGAAGG + Intronic
931735065 2:65186478-65186500 AGTTTTATATTGTGTCTTGAAGG + Intergenic
932183252 2:69668936-69668958 CCTTTTTTTTTTTTTCTTGAAGG + Intronic
933875769 2:86620458-86620480 CCTTTCTTCAGGTGACTTGATGG - Exonic
934667786 2:96185411-96185433 CCTTTTTTCTGGAGTCTTGAGGG - Exonic
935438644 2:103065478-103065500 ACTTTTTTTATGTGTCTTGAAGG + Intergenic
935612010 2:105035590-105035612 CCCTTACTATGATGTCTTGATGG + Intergenic
936732728 2:115403844-115403866 GTTTTTTTATGATGTCTTTAAGG - Intronic
937965301 2:127502756-127502778 GCTTTTTTTTGGTGTTTTTATGG - Intronic
939125183 2:138169388-138169410 CCTTTTTGGTGGAGTCTTTAGGG - Intergenic
940164338 2:150752738-150752760 GTTTTTTTATGTTGTCATGATGG + Intergenic
941332749 2:164199435-164199457 GGTTTTTTATGGTGTTGTGAGGG - Intergenic
942477373 2:176342016-176342038 CCTTGTTTGTGGTATCTTAAGGG + Intergenic
943679523 2:190753223-190753245 CATTTTTTCTGGAGTCTTGAGGG + Intergenic
944737435 2:202580353-202580375 CCTTTTTTGTTGTGTCCTGCTGG + Intergenic
945015167 2:205507580-205507602 CCTTATTTATGGAGTCTGGGTGG - Intronic
945816542 2:214611677-214611699 CCTCTGTTTTGGTTTCTTGAAGG + Intergenic
947263895 2:228254518-228254540 CTTTTTTTATGCTGTCATGGAGG + Intergenic
948090923 2:235294606-235294628 CCTTTTTTTAAGTATCTTGATGG + Intergenic
948977502 2:241472473-241472495 CCTGTTTTATGGTGTTCTGTGGG + Intronic
1169289789 20:4339377-4339399 CCTTTGTTATGGTGTTATGTTGG + Intergenic
1169585832 20:7084207-7084229 CATTTTTTATGTTGTATTGTTGG - Intergenic
1169696463 20:8392794-8392816 ACTTTTTTATGGTACATTGAAGG - Intronic
1171147685 20:22800144-22800166 CCTTTTTTATGGTATTATCAGGG - Intergenic
1171274688 20:23846439-23846461 CATTTTGTATGGTATCTTGCAGG - Intergenic
1173412108 20:42821091-42821113 CCTTTTTTGTTGTGTCTTCCTGG - Intronic
1178551953 21:33548021-33548043 CCTTTTTTCTGTAGTCTTAATGG + Intronic
1178612305 21:34095038-34095060 CCTTTGGTTTGCTGTCTTGATGG - Exonic
1179234340 21:39531621-39531643 CTTTTTTAAAGGTGGCTTGAGGG - Intergenic
1180635577 22:17260686-17260708 CCCTTTTTTTGGTGTTTTGTTGG + Intergenic
1182247731 22:28973278-28973300 CCTTTTTTACACTTTCTTGATGG + Intronic
951139043 3:19139805-19139827 CCCAGTTTATGGAGTCTTGAGGG + Intergenic
951223109 3:20090095-20090117 GCTTTTTGGTGGTGTCTTTAGGG + Intronic
952724832 3:36573050-36573072 CTTTCTTTATTGTGTCCTGAAGG - Intergenic
952913469 3:38211124-38211146 CCTTTTTGGTGGTGTGGTGAGGG - Intronic
953245514 3:41187745-41187767 CTTTGTTTATGGTGTTTTTATGG - Intergenic
957174035 3:76781300-76781322 TATTTTTTATGGAGTCTTTAGGG + Intronic
958650388 3:96930336-96930358 CCATCTTTATGGGGTCTTTAAGG + Intronic
961352110 3:126310713-126310735 CCTTTTTTAAGAAGTCTTAATGG + Intergenic
964931174 3:162025276-162025298 CATTATTTATGGTGTAATGATGG - Intergenic
965919524 3:173895471-173895493 CCTGTTATATGGTGTCTGAAAGG - Intronic
966349877 3:179021588-179021610 CCTTTTCTATGCTGTCTTCAAGG - Exonic
966455926 3:180116248-180116270 CATATTTTTTGGTGTTTTGACGG + Intergenic
967556608 3:190865960-190865982 CCTTTTGTATTGTGTCTAAAGGG + Intronic
967629399 3:191727032-191727054 CATATTTTATGTGGTCTTGATGG + Intergenic
967896689 3:194401204-194401226 CCTTTTTTATGGTGTCTTGAAGG - Intergenic
969184269 4:5463834-5463856 CTTGCTTTATGCTGTCTTGAAGG - Intronic
974312620 4:60232619-60232641 CTTTTTGTATAGTGTCTTGCAGG + Intergenic
974633284 4:64524228-64524250 AGTTTTTTATGGAGTCTTTAGGG + Intergenic
974805379 4:66873043-66873065 CCTTTTGTGTGCAGTCTTGAGGG + Intergenic
975036644 4:69692624-69692646 ACATTTTTATGGAGTCTTTAAGG + Intergenic
975941899 4:79658017-79658039 GCCTTTTGATGGTGTCTTTAGGG - Intergenic
975985608 4:80199062-80199084 CCTTTATTAAGGTGTCATAAAGG - Intronic
976459210 4:85288410-85288432 CCTTTTTTATGGAGGCTTTAGGG - Intergenic
976886719 4:89994203-89994225 ACTTTTTTATGGAGTCTAAAAGG + Intergenic
977328863 4:95611340-95611362 CATTTTCTGTGGTGTCTTAATGG + Intergenic
978222983 4:106299490-106299512 ACTTGTTTATGATGTTTTGAAGG - Intronic
978926678 4:114253757-114253779 CATCTTTTATAGTGTCTTGTAGG - Intergenic
979302204 4:119099868-119099890 CCCCTTTTATGTTGTGTTGATGG - Intergenic
979684232 4:123494131-123494153 CCTTGTCTATGTTGTCTGGATGG + Intergenic
980165230 4:129218079-129218101 CCTCTTTTATGGTCTCTAGCAGG + Intergenic
981225971 4:142294694-142294716 CCTCATTTATGGTGGCTTGTGGG - Intronic
984498311 4:180526724-180526746 CCTTTTTTAGGGTGACATGAAGG - Intergenic
984515145 4:180729486-180729508 CCTTTATCATGTTGTCTTTAGGG + Intergenic
984854291 4:184180322-184180344 ACTTTTTAATGGTCTCTTCAGGG - Intronic
986329000 5:6703690-6703712 CCTTTCTCAAGGTGTCTTCAAGG + Intergenic
989164600 5:38422106-38422128 CCTTGTTCATGGTCTCTTTAAGG + Intronic
989573959 5:42971885-42971907 TTTTTTTGATGGTGTCTTGCTGG + Intergenic
990384056 5:55242316-55242338 CCTGTTTTTTGGTTTCTTGTAGG + Intergenic
991252566 5:64579923-64579945 CATTTTCTATGCTGTCTTGATGG - Intronic
991919785 5:71644487-71644509 TCTTTTTTCTGATGTCTTGGAGG - Intronic
992504739 5:77375740-77375762 GCATTTTTATCGTGTCTGGAAGG + Intronic
994084050 5:95739353-95739375 CCTTCTTTTTGGTCTCTTTAAGG + Intronic
994153708 5:96478787-96478809 CCCATTTTATGGTTTCTGGAGGG - Intergenic
996364595 5:122687693-122687715 CCGTTTTTATGGAGTCTTTGGGG - Intergenic
997796851 5:136819226-136819248 CTTTTTTTATGTTGCCCTGAGGG - Intergenic
997982656 5:138478693-138478715 TCTGTTTTATGGGGACTTGAGGG - Intergenic
999441757 5:151606665-151606687 TGTTTTTGATGGTGCCTTGAAGG + Intergenic
999908535 5:156170147-156170169 TCTTATTAATGGTGTCTTGCAGG - Intronic
1001944043 5:175762517-175762539 CCTTTTTCATGGTGACAGGAAGG - Intergenic
1002509933 5:179708217-179708239 ACTTTTTTGTGTTGTCTTGTAGG + Exonic
1004344797 6:14839062-14839084 GCTTCTTTATTTTGTCTTGATGG + Intergenic
1007300247 6:40862571-40862593 TCTTTTTTGTTGTGTCATGAGGG + Intergenic
1008681146 6:53873673-53873695 GGTTTTTTATGGAGTCTTTAGGG + Intronic
1009678876 6:66864586-66864608 AGTTTTTTGTGGTGTCTTTAGGG - Intergenic
1010559889 6:77335714-77335736 AGTTTTTTATGGAGTCTTAACGG + Intergenic
1012676288 6:102116841-102116863 CTTTTTTTATGGAGTCATTAGGG + Intergenic
1014844088 6:126254683-126254705 CCTTTTCTTTGGTGTCATGCTGG + Intergenic
1016062786 6:139647550-139647572 TCTATTTTATGGTTTCTTGATGG - Intergenic
1016501616 6:144726729-144726751 CCTTTTTAAGGCTGTCTAGAAGG - Intronic
1016784376 6:147994007-147994029 CCTTTTTTTTGGTTACTTGCTGG + Intergenic
1017141259 6:151192203-151192225 TCTATTTTATGTTGTCTTGTTGG - Intergenic
1017173926 6:151484060-151484082 CCTTCTTTGTGGTGTCTTATGGG + Intergenic
1017532636 6:155312006-155312028 ACCTTTTTATGATGTCTTAAGGG - Intronic
1018355865 6:163015738-163015760 GCTTTTTGGTGGTGTCTTTAGGG + Intronic
1019438710 7:1035922-1035944 CCTTTCTTGTGCTGTCTGGATGG - Intronic
1021017608 7:15553931-15553953 CCTCTTTCTTTGTGTCTTGAGGG - Intronic
1021466831 7:20953713-20953735 CTTTTTTTATGGTTTATAGATGG - Intergenic
1023715759 7:43042647-43042669 CCTATTTTTTAGAGTCTTGAAGG + Intergenic
1025019794 7:55472053-55472075 CCATTTTTTTGGTGTGTTTATGG - Exonic
1026033265 7:66813539-66813561 TTTTTTTTATTGTGTCTTGAAGG - Intergenic
1030139314 7:106288533-106288555 CCCTTTCTATGGTGTCTTTGTGG + Intergenic
1031872934 7:127107337-127107359 CCTTTTCTGTGATGTTTTGAAGG - Intronic
1033106280 7:138528150-138528172 CCTTCACTATGGTGTCTAGATGG + Intronic
1035164466 7:156977299-156977321 GGTTTTTTATGGAGTCTTTAGGG + Intergenic
1036539004 8:9685223-9685245 GTTTTTCTATGGTGTCTTCAAGG - Intronic
1037191350 8:16129744-16129766 TCTTTTTTAGGGCGTGTTGAGGG - Intronic
1037378098 8:18253960-18253982 CCTTTTTGGTGGAGTCTTCAGGG - Intergenic
1038291807 8:26256496-26256518 CATCTTTTATGGTCTCCTGAAGG - Intergenic
1038664178 8:29523078-29523100 CCTCTTTTATGGGGTATTGTTGG + Intergenic
1039883026 8:41638471-41638493 CCCTTTTTATGGTGTTTTTATGG + Intergenic
1040081122 8:43287156-43287178 CATTTTTAATGGTGTGTTCATGG - Intergenic
1040210505 8:45000476-45000498 CTCTTTTTATAGTGTCTGGAAGG + Intergenic
1040238921 8:45419688-45419710 CTCTTTTTATAGTGTCTGGAAGG + Intergenic
1040966923 8:53091991-53092013 ACTTTTTCAAGGTGTCTTGGGGG + Intergenic
1043619965 8:82177847-82177869 CCTTTTGTTTGGTTTCTTTATGG + Intergenic
1044228396 8:89745389-89745411 CGTTTTTTATCGAATCTTGAGGG + Intergenic
1045715535 8:105039335-105039357 CCTTTTTTATGGCTTTTTTATGG - Intronic
1048816846 8:138342122-138342144 CCTATTTCATGGTGTTTTGTGGG - Intronic
1051977405 9:22968030-22968052 CCTAGATTATGGTGTCTTCAAGG - Intergenic
1052384753 9:27809393-27809415 CCTTTTTTTTGGTGTAGGGAAGG + Intergenic
1055490015 9:76795301-76795323 CCATAGTTATGGTGTTTTGACGG - Intronic
1056328122 9:85498717-85498739 AGTTTTTTATGAAGTCTTGAGGG - Intergenic
1056411612 9:86333941-86333963 CCTTTTTTAAGAAGTCTTTAGGG - Intronic
1057220026 9:93252421-93252443 CCTTTGCCATGGTGTGTTGAAGG + Intronic
1061148941 9:128818162-128818184 CTTATTTTATGGTGTCATGGAGG + Intergenic
1186712210 X:12210728-12210750 CCTTTTTTAGTGTGTGTTGTCGG - Intronic
1187445484 X:19357054-19357076 CCTTTCTCATGGTGTGTTGTGGG - Intronic
1188946517 X:36311412-36311434 CCTTTTTTATGCCATATTGAGGG + Intronic
1191576295 X:62710074-62710096 CCTATTTTATATTGTCTTAAAGG + Intergenic
1191856979 X:65635014-65635036 CCTTTTTTATTCTGTCTTTATGG + Intronic
1192722818 X:73717602-73717624 GTTTTTTGATGGAGTCTTGAGGG + Intergenic
1193215408 X:78857668-78857690 CCTTTGTTGTGGTGTCTTCTGGG + Intergenic
1193457785 X:81752642-81752664 CATATTTTATAGTATCTTGAAGG + Intergenic
1194112983 X:89859054-89859076 TTTTGTTTTTGGTGTCTTGAAGG + Intergenic
1196340271 X:114586614-114586636 CCCTTTCTATGCTTTCTTGAGGG + Intronic
1196803107 X:119561232-119561254 CCTTTTTTTTTGTTTTTTGACGG - Intronic
1198109667 X:133491930-133491952 CCCATTTCATGGTGTCTTGGTGG - Intergenic
1198274412 X:135087779-135087801 CCATTTTCAAGGTGTCCTGAAGG + Intergenic
1198285767 X:135189956-135189978 GGTTTTTCATGGTGTCTTCAGGG - Intergenic
1199011086 X:142759783-142759805 GCTTGTTTTTGGTGTCTTCAGGG + Intergenic
1199717548 X:150517171-150517193 GCTCTTTTATGCTGTCTTCAAGG - Intergenic
1200465635 Y:3513883-3513905 TTTTGTTTTTGGTGTCTTGAAGG + Intergenic
1200694053 Y:6341321-6341343 CCTTTTTCATGATGTCCAGAAGG + Intergenic
1200987179 Y:9314427-9314449 CCTTTTGCATGATGTCCTGAAGG - Intergenic
1201041224 Y:9833398-9833420 CCTTTTTCATGATGTCCAGAAGG - Intergenic
1202032182 Y:20588652-20588674 TCTCTTTGATGGTGTCATGAGGG - Intronic
1202108558 Y:21396994-21397016 CCTTTTCCATGATGTCCTGAAGG - Intergenic
1202118410 Y:21498213-21498235 CCTTTTGCATGATGTCCTGAAGG + Intergenic
1202120862 Y:21521753-21521775 CCTTTTGCATGATGTCCTGAAGG + Intronic
1202123313 Y:21545294-21545316 CCTTTTGCATGATGTCCTGAAGG + Intronic
1202155693 Y:21884087-21884109 CCTTTTGCATGATGTCCTGAAGG - Intronic
1202158141 Y:21907628-21907650 CCTTTTGCATGATGTCCTGAAGG - Intronic
1202184594 Y:22172553-22172575 CCTTTTGCATGATGTCCTGAAGG - Intronic
1202206766 Y:22413848-22413870 CCTTTTGCATGATGTCCTGAAGG + Intronic