ID: 967896786

View in Genome Browser
Species Human (GRCh38)
Location 3:194401871-194401893
Sequence GCAGACTTCTGACCTGGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 145}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967896786_967896792 9 Left 967896786 3:194401871-194401893 CCATTACCAGGTCAGAAGTCTGC 0: 1
1: 0
2: 1
3: 19
4: 145
Right 967896792 3:194401903-194401925 GTTACCTGGCTTAAGGGGCTTGG 0: 1
1: 0
2: 0
3: 5
4: 100
967896786_967896790 3 Left 967896786 3:194401871-194401893 CCATTACCAGGTCAGAAGTCTGC 0: 1
1: 0
2: 1
3: 19
4: 145
Right 967896790 3:194401897-194401919 AAAACAGTTACCTGGCTTAAGGG 0: 1
1: 0
2: 1
3: 12
4: 153
967896786_967896788 -5 Left 967896786 3:194401871-194401893 CCATTACCAGGTCAGAAGTCTGC 0: 1
1: 0
2: 1
3: 19
4: 145
Right 967896788 3:194401889-194401911 TCTGCTGTAAAACAGTTACCTGG 0: 1
1: 0
2: 1
3: 9
4: 134
967896786_967896794 24 Left 967896786 3:194401871-194401893 CCATTACCAGGTCAGAAGTCTGC 0: 1
1: 0
2: 1
3: 19
4: 145
Right 967896794 3:194401918-194401940 GGGCTTGGCTATTCAAAAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 78
967896786_967896791 4 Left 967896786 3:194401871-194401893 CCATTACCAGGTCAGAAGTCTGC 0: 1
1: 0
2: 1
3: 19
4: 145
Right 967896791 3:194401898-194401920 AAACAGTTACCTGGCTTAAGGGG 0: 1
1: 0
2: 0
3: 7
4: 135
967896786_967896789 2 Left 967896786 3:194401871-194401893 CCATTACCAGGTCAGAAGTCTGC 0: 1
1: 0
2: 1
3: 19
4: 145
Right 967896789 3:194401896-194401918 TAAAACAGTTACCTGGCTTAAGG 0: 1
1: 0
2: 4
3: 10
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967896786 Original CRISPR GCAGACTTCTGACCTGGTAA TGG (reversed) Intergenic
900185746 1:1332440-1332462 GCTGACCTCTGACCTGGTCATGG + Exonic
904202913 1:28833274-28833296 GCAGTCTCCTGAGCTGGAAAAGG - Intronic
905655767 1:39684974-39684996 GCAGGCTTCTGTCCTGAGAAGGG + Intronic
906892136 1:49728818-49728840 GAAGACTCCTGAACTGGGAATGG - Intronic
907422184 1:54354964-54354986 GCAGTCTTCTGGCCTTGGAAAGG - Intronic
908870246 1:68602228-68602250 GAAGCCTTGTGACCTGGAAATGG + Intergenic
910323215 1:85973656-85973678 GCAGACGGCTGACCGGTTAAAGG + Intronic
911187116 1:94915413-94915435 GCAGACTTCGGGACTGGAAAGGG - Intronic
913066012 1:115255645-115255667 GCAGACTTGTTTCCTGGTGAGGG - Intergenic
913081312 1:115389683-115389705 GCTGACTTTTGACCTAGTCATGG + Intergenic
916182155 1:162094763-162094785 GTTGACTTCTGTCCTGTTAATGG + Intronic
916891622 1:169117299-169117321 ACAGCCTTATGACTTGGTAAAGG + Intronic
921045772 1:211476990-211477012 GCAGACTGCTCAGCTGGTAGGGG - Exonic
922828108 1:228535676-228535698 GCTGACTTCTGGCATTGTAATGG - Intergenic
924951677 1:248890268-248890290 GGGGACTTCTGACCTAGTTAGGG - Intergenic
1067248116 10:44563386-44563408 GCAGACTTGTTTCCTGGTGAAGG + Intergenic
1070992001 10:80740811-80740833 CCAGACTTCTGAACTAGTCAAGG - Intergenic
1071283532 10:84124444-84124466 CCAGACTTCTGAACTGGTTAAGG + Intergenic
1071699585 10:87915802-87915824 GCAGACCTCTTACCTGGGCAAGG - Intronic
1075260946 10:120963484-120963506 GCAGCCTTCTGACCTGGGCTGGG - Intergenic
1076556210 10:131322928-131322950 GCAGCCTCCTGCCCTGGCAAGGG - Intergenic
1079874522 11:25839948-25839970 GCAGATTTTTGACATGGTAAAGG + Intergenic
1082046306 11:47731628-47731650 GCAGACTGCTGTCCTGGGACAGG - Intronic
1086862411 11:91940450-91940472 GCAGACATCTGACCATGTGAAGG + Intergenic
1087175959 11:95095656-95095678 GAAGACCTTTGACATGGTAAGGG - Intronic
1092575456 12:9777638-9777660 GCAGAGTTCTGAGCTTGCAAAGG - Intergenic
1093119149 12:15246540-15246562 GCAGTTTTCAGAGCTGGTAATGG - Intronic
1094322522 12:29200993-29201015 GCAGACCCCTGACCTGGTGACGG - Intronic
1095162815 12:38937009-38937031 TCAGACTTTTGAGCTGGTTAAGG + Intergenic
1095430104 12:42124879-42124901 GCAAACATCTAACCTGGTATTGG + Intronic
1097075782 12:56392692-56392714 GCAGACTTCAGGGCTGGAAATGG + Intergenic
1102605792 12:114066247-114066269 CCAGACTTCTGAACTGGTTAAGG - Intergenic
1104321014 12:127750812-127750834 TCAGTCTTCTGACCTTGTACAGG + Intergenic
1104469971 12:129022045-129022067 GCAGAGTTCTGACTGGGTGATGG + Intergenic
1105225125 13:18424853-18424875 TCAGACTTCTGAACTGGTCAAGG - Intergenic
1108578609 13:51810215-51810237 GCAGAGCTCTGCGCTGGTAATGG + Intergenic
1112567129 13:100561290-100561312 GCTTACATCTGACTTGGTAATGG + Intronic
1113060842 13:106321231-106321253 AAAGACTTCTTACCTGCTAAGGG - Intergenic
1113524914 13:110967151-110967173 CCAGACTTCTGAACTGGTTAAGG - Intergenic
1114009234 14:18349221-18349243 TCAGGCTTCTGAACTGGTCAAGG - Intergenic
1114896119 14:26993420-26993442 GCAAACATCTCAGCTGGTAATGG + Intergenic
1116650782 14:47589420-47589442 GCAGTCTTCTGAACTAATAATGG - Intronic
1116770891 14:49125751-49125773 ACAGACTTCTGACCTAAGAATGG + Intergenic
1118626872 14:67667476-67667498 TAAGACTACTGACCTTGTAAGGG + Intronic
1123392425 15:19889824-19889846 TCAGGCTTCTGAACTGGTCAAGG - Intergenic
1129175909 15:73839599-73839621 GCAGCCTTCTCATTTGGTAATGG - Intergenic
1129373180 15:75110559-75110581 GCAGAATGCTGGCCTGGCAAGGG + Intronic
1130497773 15:84478281-84478303 GCAGACTTCTGAGCAGCCAAGGG - Intergenic
1133685699 16:8163400-8163422 GCAGACTTCTGCTTTGGAAATGG + Intergenic
1136520553 16:30792919-30792941 GCAGACCCCTGACCTGGCGATGG + Intergenic
1138791989 16:59916207-59916229 GCAGATTTCTGAACTAGTTAGGG + Intergenic
1141164870 16:81653589-81653611 GCAGACTTCTCATCTGGAGAAGG + Intronic
1143584737 17:7845441-7845463 GGCCACTGCTGACCTGGTAAGGG + Exonic
1145847439 17:28053586-28053608 GCAGACTTCTTACAGGGGAATGG + Intronic
1145937795 17:28725535-28725557 GCAGACTCCTGACATGTTAGTGG - Exonic
1150367606 17:64604096-64604118 ACAGATTTTTGACCTGTTAAGGG - Intronic
1150844974 17:68647182-68647204 GCAGACCCCTGACCCGGTGACGG + Intergenic
1151113945 17:71712070-71712092 GGAGAATTTTGACCAGGTAAAGG - Intergenic
1151583204 17:74991929-74991951 GGAGAGCTCTGACCTGGCAACGG + Intronic
1152420347 17:80189485-80189507 GGAGAAGGCTGACCTGGTAAAGG + Intronic
1152877589 17:82795908-82795930 CCAGGCTTCTGACCTGGGATTGG + Intronic
1154528241 18:15314669-15314691 TCAGACTTCTGAACTGGTCAAGG + Intergenic
1157149959 18:45206815-45206837 GTAGACTGCTGATCTGTTAATGG - Intergenic
1157622804 18:49025957-49025979 GCAGACTGGTGACCTGGCACAGG + Intergenic
1159832556 18:73294765-73294787 TCAGATTTCTGACATGGGAAGGG + Intergenic
1160198840 18:76779381-76779403 GCAGATTTGGGGCCTGGTAAAGG - Intergenic
1162150474 19:8641680-8641702 GAAGACATCTCAGCTGGTAAGGG - Intergenic
1162268453 19:9595181-9595203 CCGGACTTCTGAACTGGTTAAGG + Intergenic
1165542694 19:36505454-36505476 GCAGCCTTCTGAGGTGGCAAGGG + Intergenic
925634766 2:5932671-5932693 CCAGACTGCTGACCTGGCACTGG - Intergenic
927036130 2:19178454-19178476 GCAGACTTCTGATCTAGTCTTGG - Intergenic
929640157 2:43570054-43570076 GCAGTCTTCTGCCCTGGAGAGGG + Intronic
931158607 2:59663723-59663745 GCAGACTTCTTACGTTGTGAGGG - Intergenic
935047938 2:99498575-99498597 CCAGACTTCTGAACTGGTTAAGG - Intergenic
937276833 2:120690369-120690391 CAAGAGTTATGACCTGGTAAAGG + Intergenic
938527345 2:132146132-132146154 TCAGACTTCTGAACTGGTCAAGG + Intergenic
938910310 2:135879307-135879329 GCAGACTCTAGAGCTGGTAAAGG - Intergenic
940363698 2:152822353-152822375 GCAGATTTCGTGCCTGGTAAGGG + Intergenic
940527795 2:154839837-154839859 GCAATCTTCTCACCTGGCAAAGG - Intronic
942135568 2:172921606-172921628 TCAGGCTTCTCCCCTGGTAAGGG - Intronic
944657575 2:201891421-201891443 GCAAAATTTTGTCCTGGTAAGGG + Intronic
946394617 2:219436805-219436827 GCAGACTTCGGAGCTGGGGAAGG + Intronic
946878621 2:224155615-224155637 ATAGACATCTGACCTGATAATGG - Intergenic
947193113 2:227531081-227531103 GCAGAATTCTGAGCTGTAAATGG - Exonic
1169155694 20:3327865-3327887 GAAGACTTCTGGCCAGGCAAGGG + Intronic
1173572409 20:44085966-44085988 CCACACTTCTCACCTGGTACGGG - Intergenic
1174238662 20:49115260-49115282 GCAGAGTTCTGACCATGTGAAGG + Intronic
1174766621 20:53260448-53260470 GCAGACTCTTGTCCTGGTTATGG - Intronic
1175165389 20:57040121-57040143 GCAGACTTATGTCCTGGCCAAGG - Intergenic
1176769177 21:13053871-13053893 TCAGACTTCTGAACTGGTCAAGG - Intergenic
1179136577 21:38684950-38684972 GTAGAGTTCTGATCTGATAAAGG - Intergenic
1179334237 21:40435130-40435152 CCAGACTTCAGAACTGGAAAAGG - Intronic
1180433735 22:15280031-15280053 TCAGGCTTCTGAACTGGTCAAGG - Intergenic
1180516289 22:16147940-16147962 TCAGGCTTCTGAACTGGTTAAGG - Intergenic
1184065070 22:42113954-42113976 TCAGACCTCTGAACTGGTTAAGG + Intergenic
1184251749 22:43264546-43264568 GGAGCCTCCTGCCCTGGTAAGGG + Intronic
950602321 3:14045710-14045732 TCAGACTTCTGAGCTGGTTAAGG + Intronic
953899624 3:46832685-46832707 GAAGACTTCTGTCCTGGAACTGG - Intronic
955760738 3:62279174-62279196 ACAGAATTATGACCTGGTAAAGG - Intronic
956655808 3:71549074-71549096 GTTGACTTCTGAGCTGCTAAGGG + Intronic
957173284 3:76768269-76768291 GCAGAAAACTGACCTCGTAAAGG - Intronic
959327959 3:104961917-104961939 TTAAACTTTTGACCTGGTAAAGG + Intergenic
961413860 3:126743335-126743357 GCAGACCTGTGATTTGGTAATGG - Intronic
962355037 3:134686418-134686440 GCACACTTCTGACCTGGGCTAGG + Intronic
963232512 3:142922579-142922601 GCAGACTTCTGAGCAAGGAAAGG - Intergenic
963659420 3:148105448-148105470 GCAGATCATTGACCTGGTAATGG - Intergenic
967259647 3:187629474-187629496 GCAGAATTGTGAACTGGGAAAGG - Intergenic
967896786 3:194401871-194401893 GCAGACTTCTGACCTGGTAATGG - Intergenic
967917674 3:194590841-194590863 GCAGGCTGCTGAACTGGTCACGG - Intronic
969682177 4:8649514-8649536 GCAGACCTCTGACCTGGGCCTGG - Intergenic
970323640 4:14900506-14900528 GCTGACTTCTGAACTGGAAAAGG - Intergenic
977504183 4:97880850-97880872 GCATCCTTCTGAACTGGTATTGG - Intronic
979544408 4:121923276-121923298 GCACAGTGCTGACCTGTTAAGGG - Intronic
983742733 4:171155368-171155390 GCAGAGTTCTGAGCTGGTGCAGG - Intergenic
984213908 4:176884155-176884177 ACAGTCTTCTGACCTGGAAGAGG + Intergenic
989615645 5:43334760-43334782 CCAGACTTCTGAACTGGTTAAGG + Intergenic
992991139 5:82285021-82285043 CCAGACTTCTTTCCTGGTCAGGG - Intronic
993885578 5:93411774-93411796 GCAGAATCCTTACCTGGTAGGGG - Intergenic
993959215 5:94276367-94276389 GCAGACTTCTTTCCTGAGAAAGG + Intronic
995025634 5:107418547-107418569 GTAGAGTTCTGACCTCCTAAGGG - Intronic
995122375 5:108549853-108549875 GCAGACCTGAGACCAGGTAATGG + Intergenic
998883645 5:146671467-146671489 GCAGCTTTCAAACCTGGTAAAGG + Intronic
1002567229 5:180118946-180118968 GCAGACCTCAGCCCTGGTCAGGG - Intronic
1002845538 6:941336-941358 GAAGACATCTCACCTGGTAAAGG + Intergenic
1003598548 6:7496691-7496713 GCACACTTCTGTCCTGGTAAAGG + Intergenic
1003621695 6:7706440-7706462 GCACACTTCTAAACTGGTCATGG - Intergenic
1006050086 6:31335650-31335672 CCAGACTTCTGAACTGGTCAGGG + Intronic
1006310941 6:33258983-33259005 GCAGACCCCTGACCCGGCAACGG + Intronic
1006357520 6:33568699-33568721 GCCGAGTGCTGTCCTGGTAAGGG - Intergenic
1006437638 6:34034503-34034525 GCAGGCTTCTGAGCAGGTGAGGG - Intronic
1007549785 6:42720451-42720473 GCAGACCTGTCACCTGGGAAGGG + Intronic
1011105071 6:83770200-83770222 GCAGACTTCCTCCCTGGTCAGGG - Intergenic
1017971567 6:159316142-159316164 GCAGCCTCCTGACCTGGCCAGGG - Intergenic
1023798343 7:43811987-43812009 CCGGACTTCTGAACTGGTCAAGG - Intergenic
1024285539 7:47754277-47754299 GCAGACTTCTCATCTGACAAGGG - Intronic
1027164304 7:75823630-75823652 ACAGACTTCTGCCCTGGAAAGGG + Intergenic
1030155390 7:106449369-106449391 GCAGAATTCTTACCTGGTTCTGG - Intergenic
1031522487 7:122783507-122783529 GCAGACCCTTGACCTGGTGATGG + Intronic
1031994403 7:128219871-128219893 GCAGGCATCTGACCTGGAACTGG - Intergenic
1032108471 7:129054903-129054925 AGAGCCTTCTGCCCTGGTAACGG - Exonic
1033164574 7:139028835-139028857 GCAAACTTCAGACCTGCAAACGG - Exonic
1034784144 7:153909922-153909944 GCTGTCTTCTGTCCTGCTAAGGG + Intronic
1034785805 7:153925024-153925046 GCAGGCTTCTGACCTGGCCCTGG - Intronic
1037595675 8:20352253-20352275 GCAGTCTTGTGAGCTGCTAATGG - Intergenic
1038256252 8:25953946-25953968 GCAGATTTGAGACCTGTTAAAGG + Intronic
1038824886 8:30989438-30989460 GCAGACGTCTTTCCTGCTAAAGG - Intergenic
1039608045 8:38899088-38899110 GCAGGCTTGTGCCCTGGGAATGG - Intergenic
1042631217 8:70818939-70818961 ACAGACTTCTTCCCTGGAAAAGG + Intergenic
1045560421 8:103256455-103256477 GCAGATTAGTGACCTGGTAGTGG - Intergenic
1049856914 8:144867973-144867995 GGAGACCTCTCACCTGGTACTGG + Intergenic
1051389792 9:16551872-16551894 TGGCACTTCTGACCTGGTAAGGG - Intronic
1052042481 9:23754887-23754909 GCTTACTTCTGAACTGGTACAGG - Intronic
1052090899 9:24326152-24326174 GCAGAGTTCTGAGGTGGGAAAGG + Intergenic
1056731918 9:89173218-89173240 GCAGACACCTGGCCTGGTGAAGG - Intronic
1059037625 9:110774637-110774659 CAAGACTTCTGAGCAGGTAAAGG - Intronic
1059410752 9:114130827-114130849 GGAAACTTCTGGCCTGGTTAGGG - Intergenic
1061832765 9:133306179-133306201 GAGGACTTCTGACCTGACAAAGG + Intergenic
1062128704 9:134880906-134880928 GCAGACACCTGTCCAGGTAAGGG + Exonic
1062390641 9:136332366-136332388 GGAGGCTTCTGGCCTGGGAAGGG - Intronic
1185855840 X:3534250-3534272 GCAGACATCTGCAGTGGTAATGG + Intergenic
1188543699 X:31278325-31278347 GCAGTCTTATTCCCTGGTAAGGG + Intronic
1196025071 X:111033512-111033534 GTAGACATCTGAGCTGGCAAAGG + Intronic
1196026200 X:111043816-111043838 GCAGACTTCTCACCTTCTATTGG + Intronic
1196054380 X:111339450-111339472 GCAGAGTTCTGAGGTGGTATAGG - Intronic
1196374425 X:115017567-115017589 GCACACTTCTGACCAGGTTATGG + Exonic
1199343312 X:146708183-146708205 GCAGACCTCTTACCTAGTGACGG + Intergenic