ID: 967898244

View in Genome Browser
Species Human (GRCh38)
Location 3:194418116-194418138
Sequence AAGCAATTGCTGAAACAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 334}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967898244 Original CRISPR AAGCAATTGCTGAAACAAAT GGG Intronic
902068887 1:13714718-13714740 AAGCAAGTGCATAAAGAAATAGG + Intronic
904070596 1:27793576-27793598 AATGAATTGCTGAAAGAATTAGG + Exonic
906370006 1:45245715-45245737 CAGTAATTGCTGAATCAAAGGGG - Intronic
907345617 1:53776652-53776674 AAACAATTACTGAGACACATTGG - Intronic
907658533 1:56370197-56370219 GAGAAATGGCTGAAACAAATTGG + Intergenic
908983421 1:69986354-69986376 AGGCAATTGTTGCAACATATTGG - Exonic
909366600 1:74830973-74830995 AAGCAACAGTTGAGACAAATTGG + Intergenic
910080589 1:83337096-83337118 AAGCTCTTACTGCAACAAATAGG - Intergenic
910651329 1:89571384-89571406 AAACCATTGCTCAAAGAAATTGG - Intronic
910730765 1:90393325-90393347 AAGCACTGGCTGAAACCATTGGG - Intergenic
911321381 1:96417264-96417286 AAGCACTTGCTTAAACCAAAGGG - Intergenic
911903931 1:103541050-103541072 AAGCAGTTGCCGAAATAAAATGG - Intronic
914420164 1:147521793-147521815 CAGCAATGGCTGAAACAATAAGG - Intergenic
914686392 1:149983549-149983571 CAGCAATTGGAGAGACAAATTGG + Intronic
915705009 1:157835627-157835649 AAGCATTTGCTCAACCAAGTAGG + Intronic
915870771 1:159557413-159557435 AAGCCATTGCTCAGACAAGTAGG + Intergenic
916639814 1:166715759-166715781 AAGCATTTGTAGAAAAAAATGGG - Intergenic
916649188 1:166819181-166819203 AAACAGTGCCTGAAACAAATGGG + Intergenic
918544043 1:185662040-185662062 AAGCTAGTGCTGAAACAAAATGG + Intergenic
918550758 1:185739643-185739665 AAGCAAGGTCTGAAACATATAGG - Intronic
918564184 1:185907700-185907722 CAGCAATGGCTGAAACAACTAGG + Intronic
919371856 1:196738502-196738524 AGGAAATGGCTGAAACAAAGTGG + Intronic
922024070 1:221734307-221734329 AAGTAATTGCAAAAACATATTGG - Intronic
922115902 1:222614308-222614330 AAGAGATAACTGAAACAAATAGG - Intergenic
922956651 1:229607637-229607659 GATCAATTGCTGAATCATATAGG - Intronic
923742372 1:236667232-236667254 AAAGAATAGATGAAACAAATAGG - Intergenic
924330570 1:242936855-242936877 AAGCATTTCCTGTATCAAATTGG - Intergenic
1063478654 10:6350869-6350891 AAGAAATAGCTGAACCAGATTGG + Intergenic
1063636795 10:7789314-7789336 AAGCATTAGTTGAAATAAATAGG + Intronic
1063850820 10:10187930-10187952 AAATAATTGCTAAAAGAAATAGG - Intergenic
1063853648 10:10222197-10222219 AAGGTATTGCTGTCACAAATAGG - Intergenic
1064141242 10:12792405-12792427 TAGCAATTGCAGAAACAAGTTGG - Intronic
1066432580 10:35366561-35366583 AAGCAACTGCTGAAAAACCTTGG - Intronic
1067449102 10:46370601-46370623 AAGCAATTCCTCCAACAAAACGG - Intronic
1067588267 10:47490164-47490186 AAGCAATTCCTCCAACAAAACGG + Intronic
1067635392 10:47998255-47998277 AAGCAATTCCTCCAACAAAACGG + Intergenic
1067725075 10:48763935-48763957 AAGGAAATGCTGAAACAAAACGG + Intronic
1070131953 10:73662261-73662283 AAGCAATTCCTCCAACAAAAGGG + Intronic
1071190286 10:83091253-83091275 AAGAAACTGCATAAACAAATGGG + Intergenic
1071609734 10:87021815-87021837 AAGCAATTCCTCCAACAAAAGGG - Intronic
1072150923 10:92682653-92682675 CAGCAATGGCTAAAATAAATGGG + Intergenic
1072997847 10:100262088-100262110 TAGCAATTCAGGAAACAAATGGG + Intronic
1073936043 10:108633251-108633273 GTGAAATTGCTGAAACATATGGG + Intergenic
1074584517 10:114754340-114754362 AAGCAATTATTGAAAGAATTGGG - Intergenic
1074799249 10:116982552-116982574 AAGCCAGTTCTGAAACAAAAAGG - Intronic
1075143480 10:119862569-119862591 AAGCAAATACATAAACAAATTGG - Intronic
1078672968 11:13381338-13381360 CTGCGATTGCTGAAACAATTTGG + Intronic
1079433288 11:20418499-20418521 AAATAATTTCTGATACAAATAGG + Intronic
1079759603 11:24311783-24311805 AATCAATTGATGAAAAAAAATGG - Intergenic
1080218511 11:29873418-29873440 AAGCCACTGCTCAAAGAAATTGG - Intergenic
1080441247 11:32296700-32296722 AAGCAAATGCAGAAAGAAATAGG + Intergenic
1085117650 11:73944436-73944458 AAACAAATGATGAAAAAAATGGG - Intergenic
1085970451 11:81583812-81583834 AAGAGATTGCTGAATCAAACTGG + Intergenic
1086454695 11:86949483-86949505 AAGCAGTTGCTGAAGCAGACAGG + Exonic
1087500710 11:98949830-98949852 AAACAAATGATAAAACAAATGGG - Intergenic
1087748498 11:101978368-101978390 AACGAATTGCTGAAACTAAGCGG + Exonic
1089102363 11:115974154-115974176 AAGCAATGGCAGAAATAACTTGG - Intergenic
1090259780 11:125310969-125310991 AAGCAATACTTGAAACAAAATGG - Intronic
1091953064 12:4611330-4611352 AACCAACTGCTGAGACAGATGGG + Intronic
1092335024 12:7624778-7624800 AAGCAGATGCTAAAACAAAGTGG + Intergenic
1092508876 12:9132248-9132270 TAGCAGCTGCTTAAACAAATAGG - Intergenic
1092650654 12:10631362-10631384 AAGCAGACCCTGAAACAAATTGG + Intronic
1093493337 12:19728515-19728537 AAACATTTGCTGAATAAAATAGG + Intergenic
1093512002 12:19940555-19940577 ATTAAATTGCTGAAACAAATTGG + Intergenic
1095725173 12:45444538-45444560 AATCAATAGCAGAAAAAAATGGG + Intergenic
1096278725 12:50233014-50233036 AAGCAACTGCTGGCAGAAATAGG - Intronic
1096370082 12:51062054-51062076 AAGCAAAAACTGGAACAAATAGG + Exonic
1097415492 12:59311101-59311123 ATGCAATTGCTGAGCCAAAGTGG + Intergenic
1097460692 12:59858209-59858231 AAGAAACTGCATAAACAAATGGG + Intergenic
1097866936 12:64566907-64566929 AAGCAATTGCTGAAGCGATTAGG + Intergenic
1098323104 12:69270431-69270453 AAGTAATTGCAGCATCAAATCGG - Exonic
1098414543 12:70217967-70217989 AAGCAAAAGCTGAAAAAAAGGGG - Intergenic
1098688624 12:73457926-73457948 AAGCAAATGCTCTAACAAACAGG + Intergenic
1098779956 12:74674438-74674460 AAGCAAATACTGAAATAAAAAGG + Intergenic
1099542729 12:83933645-83933667 ATGGAATTGCTGGATCAAATGGG - Intergenic
1099589286 12:84566951-84566973 CAGCAAATGCTGAAAAAACTAGG + Intergenic
1099848869 12:88065630-88065652 TATCATTTGCTGAATCAAATAGG - Intronic
1100144833 12:91664947-91664969 AAGCAATTGCCCCAACAACTAGG - Intergenic
1100199077 12:92279217-92279239 AAGGAATTGCTGAAGAAAGTGGG - Intergenic
1100253926 12:92861835-92861857 AAGAAATTGATGAAAAAAAGAGG + Intronic
1101012772 12:100468115-100468137 AATTAATTGCTGAATAAAATAGG - Intergenic
1101881693 12:108630139-108630161 AGGCAAGTGTTGAGACAAATAGG - Intronic
1102194078 12:111011976-111011998 AACCAATTGCTGGGGCAAATGGG + Intergenic
1102483441 12:113239872-113239894 CAGCAAGTGCTGAAAGAATTAGG - Intronic
1105309787 13:19196069-19196091 AAAAATGTGCTGAAACAAATGGG - Intergenic
1107672990 13:42765929-42765951 AAGACATTCGTGAAACAAATGGG - Intergenic
1108249962 13:48554496-48554518 AGACAATTGCTGAAAAAAACTGG - Intergenic
1109416072 13:62043117-62043139 AACCAACTGTTGAAACTAATAGG + Intergenic
1109440548 13:62366555-62366577 AAGAAATTGTTGAAAAATATAGG + Intergenic
1110185099 13:72664642-72664664 AAGCACTTGCTGGCACAAATCGG + Intergenic
1111064938 13:83077772-83077794 AAAACATTGCTGAAAGAAATCGG + Intergenic
1111770080 13:92585407-92585429 AGGCATTGGCTGAAACAAAGGGG - Intronic
1111942947 13:94632457-94632479 ATGCAATTGGTGAAAAAAATGGG - Exonic
1112145348 13:96693643-96693665 AATAAATAGCTGAAACAATTTGG - Intronic
1113730019 13:112634788-112634810 AAACAAATGCTAAAGCAAATAGG - Intergenic
1114418957 14:22563708-22563730 AAGCTTTTCCTTAAACAAATGGG - Intergenic
1116932848 14:50707199-50707221 GAACAAATGCAGAAACAAATGGG - Intergenic
1119713332 14:76839346-76839368 AAGCAATTTGTGAATCAAAATGG + Intronic
1119991306 14:79200657-79200679 AAACAGGTGGTGAAACAAATTGG + Intronic
1120842296 14:89096711-89096733 AAGCAATCCCTGAAACCAGTAGG - Intergenic
1122764155 14:104053734-104053756 AAGCAATTCCAGAAAAATATAGG - Intergenic
1123911241 15:24969508-24969530 TAGCAATTGCATAAGCAAATTGG + Intronic
1125357045 15:38827310-38827332 AAGCTATTGCTGATCCAAAAGGG - Intergenic
1125927234 15:43572898-43572920 AAGCCATTGCTTAAGGAAATGGG + Intronic
1125940377 15:43672463-43672485 AAGCCATTGCTTAAGGAAATGGG + Intergenic
1125953267 15:43772013-43772035 CAGCAATTCCTGAAACAACTTGG - Exonic
1126176879 15:45744137-45744159 AAACAATTGCAGAATCAAAGAGG + Intergenic
1127317845 15:57814760-57814782 AAGGCATTGCTGAAAAAAAAAGG - Intergenic
1127333382 15:57960275-57960297 AGGCATTTGCTCAAAAAAATAGG + Intronic
1127506595 15:59603887-59603909 AGGCAATTTATGAAACAAAGAGG - Intronic
1127682531 15:61311492-61311514 CAGCAAATGCTGAAACTAAAGGG - Intergenic
1131545591 15:93313304-93313326 AAGAAATGGCTGGAACAAAGGGG + Intergenic
1131742808 15:95412627-95412649 TAGCAAATGCTGGAATAAATTGG - Intergenic
1131925683 15:97380985-97381007 AAACCCTTGCTGAAAGAAATCGG + Intergenic
1132109153 15:99089571-99089593 AAGCATTTGCTTTATCAAATGGG - Intergenic
1133645058 16:7756271-7756293 AATCAATTGCTGGAACAAATGGG - Intergenic
1135101071 16:19606179-19606201 CAGCAATGGCTAAAACAAACTGG - Intronic
1135150730 16:20003241-20003263 AAGCAATTGTTGAAATAATTGGG - Intergenic
1137905244 16:52314993-52315015 AAGCAATGGCTGAATCACTTGGG - Intergenic
1140104696 16:71949064-71949086 AAATAATAGATGAAACAAATTGG + Intronic
1144220624 17:13096762-13096784 AAACAATTCCTGAAACACAGTGG - Intergenic
1145002265 17:19313527-19313549 AAGCCATTTCTGATGCAAATGGG - Intronic
1146364668 17:32212842-32212864 AAGAAAAGGCTGAAAGAAATGGG - Intronic
1146643929 17:34563838-34563860 AAGCAATTGCAGGGACATATGGG + Intergenic
1146827604 17:36036953-36036975 GAGCAATTGCTGTACCATATAGG + Intergenic
1148377477 17:47161383-47161405 AAACATTTGCTGAAAGTAATAGG + Intronic
1150641081 17:66949953-66949975 ATGCACTTGCAGAAATAAATTGG - Intergenic
1150986086 17:70198615-70198637 TTCCAATTGCTGAAACAAGTAGG - Intergenic
1151861226 17:76763680-76763702 GAGCGTTTGCTGAAACAAAATGG - Intronic
1153190140 18:2529110-2529132 AAGAAAATGCTTAAACAAAGAGG - Intergenic
1155068530 18:22290825-22290847 AGGTAATTGCTGAAATAATTGGG + Intergenic
1155797274 18:30055721-30055743 AAGCCAATATTGAAACAAATAGG + Intergenic
1156057160 18:33020603-33020625 AAGCAATTGCTGATCACAATGGG + Intronic
1156409383 18:36813105-36813127 TAGCAATAGCTTAAGCAAATAGG - Intronic
1157234330 18:45949397-45949419 AAGAAATTGCTGAAAAAAAAAGG - Intronic
1157240140 18:46001423-46001445 AAACAATTGGTTAAAAAAATGGG - Intronic
1159071036 18:63624410-63624432 AAGAAATTGCCAAAACAAAGGGG + Intergenic
1159429064 18:68327353-68327375 AAGATATTGCTGAAGCAAAGGGG + Intergenic
1159501141 18:69271669-69271691 AAAAAATTGATGAAAGAAATTGG + Intergenic
1164756301 19:30692212-30692234 AAGAAACTGCTGAAACCAAACGG + Intronic
1164793659 19:31008927-31008949 AAGCCTTTTCTGAAACACATTGG - Intergenic
1166625597 19:44351441-44351463 AAGAAATTTTTTAAACAAATAGG - Intronic
1167138361 19:47632197-47632219 AAGGAATTGCTGAGGCAAAAGGG + Intronic
1168326652 19:55542117-55542139 AATCAATTGATGAAATAAACTGG - Intronic
926374980 2:12218385-12218407 AAAAAATTGCTGAAAAAAATTGG - Intergenic
927335633 2:21920560-21920582 AAATATTTGCTGAATCAAATTGG + Intergenic
928034376 2:27807999-27808021 CAGCAAATGCTGACACAAATTGG + Intronic
929459770 2:42094589-42094611 AGGCAATTGATGAAGTAAATAGG + Intergenic
929797243 2:45069532-45069554 AGGCAATTGCTCCAACAAAGGGG + Intergenic
931111029 2:59111785-59111807 AACCAATTTCTGAAAAAAGTTGG - Intergenic
933330432 2:80886413-80886435 AAGCTATTGCTATATCAAATTGG + Intergenic
933667288 2:84973776-84973798 AAAGAAATGCTGAAAGAAATGGG - Intronic
934147103 2:89105812-89105834 CAGCAATTGATGAATCAAAAAGG - Intergenic
935049496 2:99512409-99512431 AAGTAATAGCAGAAATAAATTGG - Intergenic
935867172 2:107402373-107402395 AACTAAGTGCTGAAAAAAATGGG + Intergenic
938075176 2:128328446-128328468 GAGCATTTGCTGGACCAAATGGG + Intergenic
938477616 2:131630255-131630277 AAGCAAATGCTGAGAGAATTCGG + Intergenic
938961085 2:136342299-136342321 AAACCATGGCTGAAACAAACAGG + Intergenic
939372582 2:141321219-141321241 TAAAAATTGCTGAAACAATTTGG - Intronic
939916326 2:148048313-148048335 AAACAATTTCTTAAATAAATGGG - Intronic
940094234 2:149956069-149956091 AAGCAATGGCTGGAGCAAAAAGG - Intergenic
942392832 2:175513888-175513910 AAGCAATTACTAAAGCCAATGGG - Intergenic
944663918 2:201943430-201943452 AAGCAAATGATGAAACAAATGGG - Intergenic
945505731 2:210637990-210638012 AATCACTTGCTGAATAAAATTGG - Intronic
945618982 2:212109473-212109495 AAGTAATAGCTGAAAGAAGTGGG - Intronic
945681222 2:212916565-212916587 AAGCAATTGCTAAATGTAATGGG + Intergenic
945890625 2:215426705-215426727 AAGCAATGGGTTAAACAAAATGG - Intronic
946336540 2:219041246-219041268 AAGAAATAGATGAAACAAAGGGG + Intronic
947194685 2:227549780-227549802 AATCAATTTTTTAAACAAATAGG - Intronic
947262681 2:228241735-228241757 AAGCCATTATTGAAAGAAATAGG + Intergenic
947466200 2:230349176-230349198 AATCAATTGCTGAAACCACAAGG + Intronic
1169692552 20:8348216-8348238 AAGCATTTGCTGAAAGACAGTGG - Intronic
1171418567 20:25000707-25000729 AAGCATTTGCTTGAAGAAATCGG + Intergenic
1172167760 20:32909262-32909284 CAGCATTTGCTGAATTAAATAGG + Intronic
1173663428 20:44749885-44749907 ATTCAGTTGCTGAAAAAAATTGG + Intronic
1175207733 20:57324549-57324571 AAACAATTGCTGAAACAATTGGG + Intergenic
1177014860 21:15773837-15773859 ACACATTTGCTGAAACAAAATGG + Intronic
1177233687 21:18357621-18357643 AAGAAATTGCTAAAACATTTAGG + Intronic
1180937881 22:19637938-19637960 AAGAAAGTTCTGAAAAAAATGGG + Intergenic
1181862780 22:25832225-25832247 ATGGAATTGCTGAATCACATGGG - Intronic
1183671808 22:39277579-39277601 AAGAAAGTGCTGTAAAAAATGGG + Intergenic
1185310099 22:50149559-50149581 CATCAATTGCTAAAACAATTCGG + Intronic
949806549 3:7961752-7961774 AAACAATGGTTTAAACAAATAGG - Intergenic
950520887 3:13497070-13497092 TAGCAATTACGGTAACAAATAGG - Intronic
950886294 3:16365978-16366000 AGGCCATTTCTGAAACAAAGAGG + Intronic
951068124 3:18291828-18291850 GTGCAACTGATGAAACAAATGGG + Intronic
951376575 3:21925384-21925406 GAACAACTGCTGAAACAAATAGG + Intronic
952696877 3:36275734-36275756 AAGCAATTGCTCAAAAACAAAGG - Intergenic
955473070 3:59306729-59306751 GAGAAAATGCAGAAACAAATGGG + Intergenic
956001146 3:64731283-64731305 TAGAAAATGCAGAAACAAATGGG + Intergenic
956567151 3:70651899-70651921 AAGCAATTTCTAAACGAAATAGG + Intergenic
956657729 3:71568267-71568289 ACTCTATTGCTGAATCAAATTGG - Intronic
959464960 3:106674436-106674458 AACCAATTATTGCAACAAATTGG - Intergenic
959565727 3:107831191-107831213 AAGAAATTGCTGGAACAGAAAGG - Intergenic
959820188 3:110725019-110725041 TAGCAATTGCTAAATGAAATTGG + Intergenic
960009461 3:112817693-112817715 ATTTAATTGCTGAAACAAACAGG - Intronic
960905963 3:122601797-122601819 ATGCAACTGCTGAATCATATGGG + Intronic
962152864 3:132911346-132911368 AAGCAGATGCTGAAACAATTAGG - Intergenic
962478266 3:135776680-135776702 AAACAATTGCTTTAAAAAATGGG + Intergenic
963270673 3:143283074-143283096 AAGCATTTGTGGAAACAAAGAGG - Intronic
963289899 3:143476966-143476988 AAGCAATTCCAGATCCAAATTGG - Intronic
963326456 3:143868758-143868780 AAACACTTGCTTAAACAAACAGG + Intergenic
964400265 3:156291108-156291130 AGGCTCTTGCTGTAACAAATCGG - Intronic
966367088 3:179201383-179201405 AAGTAATTGCTGAAGCAATCAGG + Exonic
966393830 3:179480798-179480820 AAGCATTTGCTAAAATAATTAGG + Intergenic
966450939 3:180060720-180060742 CAGAAATTGGTGAAACATATTGG + Intergenic
966970030 3:185036087-185036109 AAAACATTGCTGAAAGAAATCGG + Intronic
967541680 3:190675564-190675586 AAGCAATCATTGATACAAATTGG - Intergenic
967898244 3:194418116-194418138 AAGCAATTGCTGAAACAAATGGG + Intronic
970198541 4:13577116-13577138 TTGCAAGTGCTGAAACAAAAAGG - Intronic
970247842 4:14081885-14081907 AAGCAAGCACTGAAATAAATGGG + Intergenic
970975519 4:22039054-22039076 AAGCAAATGCTGAGAGAATTTGG - Intergenic
971131643 4:23817616-23817638 CACCATTTGTTGAAACAAATAGG + Intronic
971309208 4:25509888-25509910 AAGAAACAGTTGAAACAAATAGG - Intergenic
972137266 4:35907863-35907885 AGGCAAAGGCTGCAACAAATTGG + Intergenic
973837003 4:54819656-54819678 TAGCACTTGCTCAAACTAATTGG + Intergenic
976385733 4:84455819-84455841 AAGGAATTGGTGAAAGAAGTTGG - Intergenic
977861827 4:101970446-101970468 AAGAAATTGATGAAAGAAATTGG - Intronic
979557036 4:122060103-122060125 AAGCAAAAGCTGAAATAAAATGG + Intergenic
979943672 4:126796790-126796812 AAGCAATTAATGAAATAAAAAGG - Intergenic
980177670 4:129366328-129366350 AAGCAATTGGTGAAACCACTAGG - Intergenic
980192485 4:129542771-129542793 CAGCAATTGCTAACACAATTTGG - Intergenic
982196109 4:152916490-152916512 TAGCAATTGTTGAAATAAGTGGG + Intronic
982676761 4:158384865-158384887 AACCAATTGTTGAAATACATGGG + Intronic
982881341 4:160721028-160721050 ACGTAATTACTGAAACAATTAGG + Intergenic
982997577 4:162369145-162369167 AATCAATTCCTGGAAGAAATTGG - Intergenic
983988898 4:174094217-174094239 TAGCAATACCAGAAACAAATTGG - Intergenic
985027941 4:185757915-185757937 AAGCAATTGCTGATACAATCTGG + Intronic
986350875 5:6878382-6878404 AAGAAATTGCTGAAGATAATAGG - Intergenic
988977304 5:36527989-36528011 AAGGAGTAGCTGAAATAAATAGG + Intergenic
989787099 5:45345179-45345201 TATCAATGGCTGAAACAACTGGG + Intronic
990835180 5:60011131-60011153 AAGTGATTGCTGGAACTAATGGG - Intronic
991460337 5:66851719-66851741 AAGGAAACGCTGATACAAATAGG - Intronic
992006120 5:72479092-72479114 AAGATATTGTTGAAACAAATGGG - Intronic
992377395 5:76201656-76201678 AAACAATTGTGGAAATAAATGGG - Intronic
993095760 5:83475726-83475748 AAGTAATTGCTCAATCACATTGG - Intronic
993368943 5:87068404-87068426 AAGCAACTTGTGGAACAAATGGG + Intergenic
993666565 5:90705649-90705671 AAGCCATTGCTAAAATAAATCGG + Intronic
994417309 5:99488760-99488782 CTGCAATTTCTGAAACAATTTGG + Intergenic
994462652 5:100086406-100086428 CTGCAATTTCTGAAACAATTTGG - Intergenic
995316490 5:110780546-110780568 AAGCAAATGCTGAGAGATATTGG - Intergenic
995974802 5:118020871-118020893 AAACAGTAGATGAAACAAATAGG - Intergenic
996487269 5:124051437-124051459 AAGCAATTAATGAAACAGATTGG - Intergenic
996898523 5:128516077-128516099 GAGGAATTTCTGAACCAAATAGG - Intronic
997392182 5:133526255-133526277 AAGCAATTCATGAAACCAAGGGG + Intronic
997830082 5:137142140-137142162 AAACATTTGGTTAAACAAATTGG + Intronic
998783766 5:145686704-145686726 AAGAAATGGCGGAAACAAAAGGG - Intronic
999531413 5:152467182-152467204 AAAAAATTGTTGAAGCAAATGGG + Intergenic
1000600122 5:163263221-163263243 TAGTGATTGCTGACACAAATAGG - Intergenic
1000961341 5:167604941-167604963 AAGATATTGTGGAAACAAATAGG + Intronic
1004967591 6:20872542-20872564 GAGCAAATGCTGAAAGAAATGGG + Intronic
1005350715 6:24932551-24932573 AAACAATTGCTGAAGCAAACAGG + Intronic
1007146457 6:39638747-39638769 AAGGAATTGCTGGAACTAGTAGG + Intronic
1007452396 6:41950115-41950137 AAGCAAATGCTTAAATATATAGG - Intronic
1007872078 6:45051913-45051935 AATTAATGGCTGAAATAAATTGG + Intronic
1008344292 6:50407355-50407377 AAGTACTTGCTCATACAAATGGG - Intergenic
1008702990 6:54124141-54124163 AAGACATTTGTGAAACAAATGGG - Intronic
1008864830 6:56197398-56197420 AAACAATTGATGAAATAAAAAGG + Intronic
1009656833 6:66558370-66558392 CAGCTATTGCTGATACAGATAGG + Intergenic
1009802622 6:68559996-68560018 AAACAATTGCTTAAGGAAATGGG - Intergenic
1010852799 6:80798604-80798626 AAGTAATTCCAAAAACAAATGGG - Intergenic
1011850750 6:91625384-91625406 AGGAAATTGCTGGAACAAATTGG + Intergenic
1012195635 6:96337762-96337784 CAGGAATTGATGAAACAAGTTGG - Intergenic
1012368549 6:98473209-98473231 AACCTATTGCAAAAACAAATGGG + Intergenic
1013197800 6:107860987-107861009 AAAACATTGCTGAAAAAAATTGG - Intergenic
1013391909 6:109693774-109693796 AACCATTTGCTGAAACAAAGAGG - Intronic
1013572408 6:111442218-111442240 CAGCATTTGGTGAAACAAGTGGG - Intronic
1013603726 6:111728941-111728963 AAACAATTTGTGAAACATATGGG + Intronic
1013811209 6:114046591-114046613 AAGCAATTACTGAAAACAAAAGG - Intergenic
1013927657 6:115492923-115492945 AAGAAATTGCCAAAACAAAGGGG + Intergenic
1014197347 6:118575580-118575602 AAGCAAATGCAGAAAAAATTAGG + Intronic
1015887766 6:137936638-137936660 AAGAAATTGAAGAAAAAAATTGG - Intergenic
1015944206 6:138483438-138483460 AAGCTTTTCCTGAAACAAAATGG - Intronic
1016843879 6:148551857-148551879 AAGCAATTGCAAGAACATATTGG - Exonic
1017768917 6:157629906-157629928 AAGCAGTTGTTGACACAACTAGG + Intronic
1018105006 6:160477341-160477363 AAGCAATTTATGACACAAACAGG + Intergenic
1018113120 6:160556237-160556259 AAGCAATTTATGACACAAACAGG + Intronic
1018300815 6:162400947-162400969 AAGCAATTCTTGAATAAAATAGG + Intronic
1018514978 6:164569673-164569695 AAGCAAATGCTCTAACAAAAGGG - Intergenic
1018545093 6:164927134-164927156 AAGATATTGCTGAAAGTAATTGG + Intergenic
1019806839 7:3133380-3133402 ATACAATTGCTGAAACAATTTGG - Intergenic
1020565025 7:9784726-9784748 AAGTAATTGATGAAAAGAATAGG - Intergenic
1020956691 7:14747690-14747712 AAGCCATTAATGATACAAATTGG + Intronic
1022265651 7:28751785-28751807 AAGACATTGGTGAAAAAAATAGG - Intronic
1022841051 7:34164143-34164165 CAGCAACTGCTGGAACAAAAAGG + Intergenic
1023188258 7:37553254-37553276 AAGCAATGCCTGGAAGAAATAGG + Intergenic
1024195725 7:47057099-47057121 AAATAATTGCTGAAGAAAATGGG - Intergenic
1025857304 7:65293323-65293345 GAGCAATTGGTGAAATAATTTGG - Intergenic
1027298365 7:76802365-76802387 AAGCTCTTACTGCAACAAATAGG - Intergenic
1027838414 7:83276804-83276826 AAGCAAATGCTGAGAGAATTTGG - Intergenic
1028215829 7:88132075-88132097 AAGAAAATTATGAAACAAATGGG - Intronic
1028306610 7:89273588-89273610 ACACAATTGAAGAAACAAATGGG + Intronic
1029928545 7:104345805-104345827 TAGCAATTGCTAGAATAAATGGG - Intronic
1030405413 7:109105087-109105109 CAGTAATTGATAAAACAAATAGG + Intergenic
1030407011 7:109127934-109127956 AAACAGTAGCTGAAAGAAATAGG + Intergenic
1030438395 7:109553865-109553887 AAGCAAATGCTGACAGAATTTGG + Intergenic
1030551253 7:110963109-110963131 AAGCAAATGCAGAAACTAAGAGG - Intronic
1030710740 7:112746029-112746051 AATCAATTGCTGATAGAACTTGG + Intergenic
1030938904 7:115620348-115620370 AAGTAATTGCTGTAAGAAAAAGG + Intergenic
1031337871 7:120559080-120559102 AAGCAGTGGTTGAAAAAAATTGG + Intronic
1031574439 7:123398356-123398378 CAGCATTTGCTGAGACATATGGG + Intergenic
1031581087 7:123475856-123475878 AAGCAATTTGCTAAACAAATAGG + Intronic
1032103748 7:129006213-129006235 AAGTTATTTCTGAAACAACTTGG - Intronic
1032583393 7:133124541-133124563 AAGCAATTGCTGATACGTTTAGG + Intergenic
1033767764 7:144513254-144513276 AACAAATTTTTGAAACAAATGGG + Intronic
1034724826 7:153325668-153325690 AAGAAATTGCCAAAAAAAATTGG - Intergenic
1035098015 7:156372072-156372094 AAGCATTATCTGAAACAAAGAGG - Intergenic
1035125090 7:156602761-156602783 AAGCTTTTGCTAAAATAAATGGG + Intergenic
1035427192 7:158786910-158786932 CAGAAATTGCTGAAACAAAAGGG + Intronic
1035631816 8:1112744-1112766 ATGCAATTTCTGCAACAAAAGGG - Intergenic
1035951010 8:4020904-4020926 CAGCAATTGCTGAAACTTAAAGG + Intronic
1036192847 8:6686758-6686780 AATCAATTCAGGAAACAAATGGG + Intergenic
1036439807 8:8772069-8772091 AAGCAATTGCACAAAACAATAGG - Intergenic
1037242007 8:16787818-16787840 AGTCAATTGCTGAAATGAATAGG - Intergenic
1039349020 8:36740843-36740865 AACCAATGGCTTAAACAAAAGGG + Intergenic
1039400748 8:37266962-37266984 AAGTAATTGCTGGAAAAGATCGG + Intergenic
1039755177 8:40514983-40515005 CAGCAATTACTTCAACAAATGGG + Intergenic
1041160566 8:55038786-55038808 AACCAATTGATAAAACAATTAGG + Intergenic
1041250584 8:55930624-55930646 AGGGCATTGCTGAAACAAGTGGG - Intronic
1041507013 8:58610371-58610393 AGGCAATTACTGAAATAACTGGG + Intronic
1041634866 8:60131460-60131482 AAGCAATTGGTGAATCAAGGTGG - Intergenic
1041707272 8:60859848-60859870 ATGCAATTATTGAAAAAAATAGG + Intronic
1042401955 8:68360070-68360092 AAGCCACAGCTGAAACAAAGAGG - Intronic
1042949055 8:74182228-74182250 AAGGATTTGCTGAATCAAAAGGG - Intergenic
1043692775 8:83176722-83176744 AAGCATTTCCAGAAAAAAATTGG - Intergenic
1045960262 8:107959144-107959166 AAGCACTTGGTGAAAAAGATGGG + Intronic
1047525893 8:125633716-125633738 AAGCAATTGGTGAAATGACTTGG + Intergenic
1049600984 8:143507557-143507579 TAGCAATTTCTGCACCAAATAGG - Intronic
1050560602 9:6831216-6831238 AATCAGTGGCTGAAACAAATTGG + Intronic
1051282100 9:15452307-15452329 AAAAAAATGCTGAAACCAATAGG - Intronic
1051872747 9:21757723-21757745 AAGCGATTGCTAAAACACGTTGG + Intergenic
1052481657 9:29035964-29035986 AAGCTTTTGCGGAAACAATTTGG + Intergenic
1052885254 9:33640358-33640380 AAGCATTTGCGGAATCAAAATGG - Intergenic
1053608529 9:39685322-39685344 AAATAATTGCTTAAATAAATAGG + Intergenic
1053866377 9:42441687-42441709 AAATAATTGCTTAAATAAATAGG + Intergenic
1054244998 9:62657087-62657109 AAATAATTGCTTAAATAAATAGG - Intergenic
1054559125 9:66691618-66691640 AAATAATTGCTTAAATAAATAGG - Intergenic
1054711848 9:68518338-68518360 AAGCAATTTTTCAAACAAAATGG + Intronic
1055003869 9:71483800-71483822 AAGAAAATGCTAAAACAAATTGG + Intergenic
1055183878 9:73426408-73426430 AAGCTACTGCTCTAACAAATGGG - Intergenic
1055756200 9:79560565-79560587 AATCAATTGCTGACACACACAGG + Intergenic
1056533315 9:87506237-87506259 ATGCAGATGCTGAAATAAATTGG - Intronic
1059613161 9:115920995-115921017 AATTAATTGATGCAACAAATAGG - Intergenic
1060332306 9:122683949-122683971 AAGCAATTTCAAAAAAAAATTGG + Intergenic
1060851375 9:126879641-126879663 AAGCAACTGCTCAAACACATTGG - Exonic
1186040518 X:5472586-5472608 AAACAACTGCTCAAAGAAATTGG + Intergenic
1186041924 X:5488949-5488971 AAGTTATGGCTAAAACAAATAGG + Intergenic
1186713238 X:12223014-12223036 ATGGAATTGCTGAATCATATAGG + Intronic
1187541407 X:20199435-20199457 AAGCGATGGCAGAAACAAAAAGG + Intronic
1187728085 X:22224343-22224365 AAACATTTCCTGAAACCAATAGG - Intronic
1189187038 X:39063620-39063642 CATCAATTGCTGACTCAAATTGG - Intergenic
1189356364 X:40312910-40312932 AGGAAATGGCTGATACAAATTGG - Intergenic
1189871152 X:45384468-45384490 AAGCAATAGCTGGCTCAAATCGG - Intergenic
1189883725 X:45518230-45518252 AAGCAATTCCTGAAAAACCTAGG + Intergenic
1191571165 X:62622951-62622973 AAGCAATCTCTGAAACAGCTTGG + Intergenic
1191675332 X:63786624-63786646 AAGGGATTCCTGAATCAAATGGG + Intergenic
1192026736 X:67460921-67460943 AAGCCACTGCTCAAAGAAATAGG + Intergenic
1193287346 X:79727954-79727976 GAGCAATTGGAGAAACAAACAGG - Intergenic
1195977746 X:110545879-110545901 AAGCAAATAATAAAACAAATAGG - Intergenic
1196084491 X:111670309-111670331 CAGCTATTGCTGCACCAAATGGG + Intronic
1196693718 X:118588710-118588732 AAGCAATTGCAAAATCAAAAAGG - Intronic
1196962492 X:121018341-121018363 AAGGAAATGCTGAAAGAAAAGGG + Intergenic
1197846179 X:130805488-130805510 AAGCAATTTTTAAAACAAAAAGG - Intronic
1198229013 X:134672027-134672049 CAGCAGTGGATGAAACAAATGGG - Intronic
1198701639 X:139403150-139403172 AAGAAAGTCCTGAAACAAACAGG + Intergenic
1198896185 X:141458071-141458093 AAATAAATTCTGAAACAAATTGG - Intergenic
1199503200 X:148532378-148532400 AAGCAATTGCTGATGGTAATTGG + Intronic
1199722882 X:150555323-150555345 AAACTAGTGCTGAAACAATTGGG + Intergenic
1200361127 X:155607884-155607906 AAGACACTGCTGAAAGAAATCGG + Intronic
1201227926 Y:11835988-11836010 AAGCATTTCCTGTATCAAATTGG - Intergenic