ID: 967899980

View in Genome Browser
Species Human (GRCh38)
Location 3:194440054-194440076
Sequence ATGTGGGTAGGGAGGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 13870
Summary {0: 1, 1: 3, 2: 98, 3: 620, 4: 13148}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967899969_967899980 -6 Left 967899969 3:194440037-194440059 CCTCTCTCCCTTTCAAAATGTGG 0: 1
1: 0
2: 3
3: 27
4: 327
Right 967899980 3:194440054-194440076 ATGTGGGTAGGGAGGGAGGGAGG 0: 1
1: 3
2: 98
3: 620
4: 13148
967899967_967899980 -2 Left 967899967 3:194440033-194440055 CCTCCCTCTCTCCCTTTCAAAAT 0: 1
1: 0
2: 10
3: 85
4: 910
Right 967899980 3:194440054-194440076 ATGTGGGTAGGGAGGGAGGGAGG 0: 1
1: 3
2: 98
3: 620
4: 13148
967899966_967899980 1 Left 967899966 3:194440030-194440052 CCTCCTCCCTCTCTCCCTTTCAA 0: 1
1: 2
2: 16
3: 260
4: 2587
Right 967899980 3:194440054-194440076 ATGTGGGTAGGGAGGGAGGGAGG 0: 1
1: 3
2: 98
3: 620
4: 13148
967899965_967899980 8 Left 967899965 3:194440023-194440045 CCAGTCACCTCCTCCCTCTCTCC 0: 1
1: 1
2: 36
3: 310
4: 2210
Right 967899980 3:194440054-194440076 ATGTGGGTAGGGAGGGAGGGAGG 0: 1
1: 3
2: 98
3: 620
4: 13148
967899968_967899980 -5 Left 967899968 3:194440036-194440058 CCCTCTCTCCCTTTCAAAATGTG 0: 1
1: 0
2: 3
3: 52
4: 577
Right 967899980 3:194440054-194440076 ATGTGGGTAGGGAGGGAGGGAGG 0: 1
1: 3
2: 98
3: 620
4: 13148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967899980 Original CRISPR ATGTGGGTAGGGAGGGAGGG AGG Intronic
Too many off-targets to display for this crispr