ID: 967902273

View in Genome Browser
Species Human (GRCh38)
Location 3:194466856-194466878
Sequence GTCTAAAAGCTTCAGATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 117}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967902273_967902277 18 Left 967902273 3:194466856-194466878 CCACCCATCTGAAGCTTTTAGAC 0: 1
1: 0
2: 0
3: 8
4: 117
Right 967902277 3:194466897-194466919 GACATTTATTTCTGGCACAGAGG 0: 1
1: 0
2: 0
3: 21
4: 200
967902273_967902278 19 Left 967902273 3:194466856-194466878 CCACCCATCTGAAGCTTTTAGAC 0: 1
1: 0
2: 0
3: 8
4: 117
Right 967902278 3:194466898-194466920 ACATTTATTTCTGGCACAGAGGG 0: 1
1: 1
2: 0
3: 28
4: 308
967902273_967902276 10 Left 967902273 3:194466856-194466878 CCACCCATCTGAAGCTTTTAGAC 0: 1
1: 0
2: 0
3: 8
4: 117
Right 967902276 3:194466889-194466911 TTTCAGAAGACATTTATTTCTGG 0: 1
1: 0
2: 2
3: 49
4: 485

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967902273 Original CRISPR GTCTAAAAGCTTCAGATGGG TGG (reversed) Intronic
909061898 1:70888663-70888685 ATTTAAAAGCCTGAGATGGGAGG - Intronic
910710825 1:90178383-90178405 GTCTACCAGCTTAAGATGGAGGG - Intergenic
912921049 1:113867708-113867730 GTATAAAAACCTTAGATGGGTGG + Intronic
912928414 1:113933523-113933545 TTTTAAAAGCTTCAGTTGAGAGG + Intronic
916699005 1:167271548-167271570 GTGTAAAAAGTTGAGATGGGTGG + Intronic
919649346 1:200130530-200130552 CTGTAAGAGCTTCAGAAGGGTGG + Intronic
919914386 1:202130642-202130664 CTGTAGAAACTTCAGATGGGTGG + Exonic
920276341 1:204807662-204807684 AACTAAAAGCTCCAGCTGGGAGG + Intergenic
921620109 1:217315836-217315858 GTTCAAAAGCCTCAGAAGGGGGG - Intergenic
922594801 1:226805341-226805363 TTCTCATAGCTTCATATGGGAGG + Intergenic
923679322 1:236106328-236106350 GTATAAAAGCTTTGTATGGGAGG - Intergenic
924448044 1:244152218-244152240 GTTTAAAAGCTACAAATAGGAGG - Intergenic
924641294 1:245836062-245836084 GTCTATGAGGGTCAGATGGGTGG - Intronic
1063365066 10:5485739-5485761 GACTAAAAGCTGCAGAAGGTGGG - Intergenic
1071422231 10:85512080-85512102 GTCTATTACCTGCAGATGGGAGG + Intergenic
1074327853 10:112470400-112470422 GTATAAAAGCTTCAGTTATGTGG - Intronic
1079567138 11:21896979-21897001 GCCTAGAAACTTCAGATGGAGGG + Intergenic
1081599317 11:44481815-44481837 GTCTAAAATCTGAAGATGTGTGG + Intergenic
1081604599 11:44519566-44519588 CTCTAAAACCTTCACATTGGAGG + Intergenic
1084699738 11:70778681-70778703 GTCTAGAAGCTGCAGATCAGGGG - Intronic
1086016574 11:82175066-82175088 TCTTAAATGCTTCAGATGGGAGG - Intergenic
1086968061 11:93050868-93050890 GTCCAACACCTTCAGAGGGGTGG - Intergenic
1090826124 11:130387700-130387722 GTCTAAAAGCTTCTCAAGGCTGG - Intergenic
1091603855 12:1934276-1934298 GCCTAAAAGAGTCAGATGGCAGG - Intergenic
1093726135 12:22510885-22510907 CTCTAAAAGGCTGAGATGGGAGG + Intronic
1099062611 12:77930972-77930994 TTCTAAAAGCTTCAGGAGGGTGG - Intronic
1099399004 12:82179207-82179229 GGCAAAAAGCTAAAGATGGGAGG - Intergenic
1103000642 12:117383122-117383144 GCCTCAGAGCTTCAGATGAGTGG + Intronic
1104672083 12:130687703-130687725 GTCTATATGCTTCAGATGATGGG - Intronic
1108016998 13:46086538-46086560 TTCTATGGGCTTCAGATGGGAGG + Intronic
1116736423 14:48697639-48697661 GCCTGGAAGCTTCAAATGGGTGG + Intergenic
1117180658 14:53187955-53187977 GTCTAAAAACTACTGATGTGTGG - Intergenic
1119061344 14:71477979-71478001 GTATAAAAGTTTCAGATGCATGG + Intronic
1123092556 14:105748277-105748299 GGCCAGAAGCTTCAGATGAGAGG - Intergenic
1123098118 14:105775978-105776000 GGCCAGAAGCTTCAGATGAGAGG - Intergenic
1132222519 15:100115586-100115608 GACTAAAAGCTGCAGATCTGAGG + Intronic
1132333045 15:101025829-101025851 GTCTCAAGGCTGCAGATTGGTGG + Intronic
1137434947 16:48447442-48447464 TTGTCTAAGCTTCAGATGGGAGG + Intronic
1137566339 16:49534939-49534961 GTCCAAGAGCATCAGAGGGGAGG - Intronic
1141034164 16:80613384-80613406 GACTTCAAGCTTCAGATGGTGGG + Intronic
1142613102 17:1119755-1119777 GTGTGAAAGCTTCACAAGGGAGG + Intronic
1144404705 17:14941368-14941390 GTCTAATAGCTTCAGGATGGGGG + Intergenic
1145071680 17:19815057-19815079 CTCTAAAAGTTTCAGATTTGGGG + Intronic
1148138767 17:45313117-45313139 GTCTAAAAGCTTCAGCTCTCGGG - Intronic
1153550603 18:6258177-6258199 GACTGAAAGCTTCAGGTGGGAGG + Intronic
1153967436 18:10194750-10194772 ATCTGAAAGCTTTAGAGGGGAGG - Intergenic
1156095100 18:33520904-33520926 TTCTAAAATCTTCAGAAGGAAGG + Intergenic
1157100681 18:44726064-44726086 GTCAAAAAACTTCAGAGGGAAGG - Intronic
1167895410 19:52576894-52576916 ATCAAAAAACTCCAGATGGGTGG + Intronic
1168325829 19:55537805-55537827 GCCGGAAAACTTCAGATGGGTGG - Intergenic
925312675 2:2897006-2897028 GTCTGAAAGATTCATATAGGGGG + Intergenic
926366676 2:12139713-12139735 GTCTGAAAGCTCCAGCTGCGGGG - Intergenic
929995796 2:46825654-46825676 GTCAAGAAGAGTCAGATGGGTGG - Intronic
930973665 2:57427944-57427966 GTTTAAAAGTTTGAGGTGGGAGG + Intergenic
931183961 2:59931527-59931549 GACTGAAAGCTCCAGAGGGGAGG - Intergenic
932118946 2:69080327-69080349 GGATAGAGGCTTCAGATGGGGGG - Intronic
932945641 2:76226678-76226700 GACTATGAGCTTCACATGGGAGG + Intergenic
935882775 2:107582848-107582870 GTGAAAAAGCTTCTGAAGGGAGG + Intergenic
936660130 2:114533844-114533866 TTCTATAAGCTTCAAATGAGGGG - Intronic
939278491 2:140032085-140032107 GACAAAAAGCTTAAGATGGGGGG - Intergenic
940144619 2:150533257-150533279 GTCTTAAAGGTACAGGTGGGAGG + Intronic
941129824 2:161633453-161633475 TTCTAAAAGTTTCAGTTAGGAGG + Intronic
945784450 2:214215449-214215471 GTCTACAAGCTTCTGAAGGGAGG - Intronic
948322141 2:237078938-237078960 CTCTAAAACCATCAGATGGCTGG - Intergenic
1170039174 20:12022340-12022362 ATCTAACACCTACAGATGGGAGG - Intergenic
1170152789 20:13242719-13242741 GTATAAAAGCATCAGATGAGGGG + Intronic
1170939288 20:20835175-20835197 TTTTAAAAGCTTCTGATGGCTGG - Intergenic
1178667367 21:34560289-34560311 GGCTAAAAGCTTCGGACAGGTGG + Intronic
1182747192 22:32615109-32615131 CTTTGAAAGCTACAGATGGGAGG + Intronic
1182863492 22:33581912-33581934 ATCTTAAAGCTTCACATGGCTGG + Intronic
1184029035 22:41880253-41880275 GTCTAAAAGCTACTGCTGGCCGG + Intronic
1184299727 22:43550373-43550395 GTCTAAAATGTTCAGAAGGCCGG + Intronic
951343983 3:21523626-21523648 GTCTGAAAGCTTCACATTTGGGG - Intronic
954020352 3:47735307-47735329 GGCTAAAAGCTAAAGATGAGGGG + Intronic
959276200 3:104279836-104279858 GTCTTAAAGATTCAGATGTAAGG - Intergenic
963005959 3:140726447-140726469 GTCTCAGAGCTGCAGAGGGGAGG - Intergenic
965434735 3:168635837-168635859 CTCTAATATCTTCAGATGTGTGG - Intergenic
967182277 3:186916427-186916449 GTCTGAAAGCTGCATTTGGGTGG + Intergenic
967902273 3:194466856-194466878 GTCTAAAAGCTTCAGATGGGTGG - Intronic
968522316 4:1039594-1039616 GTCTGAAGGCTTCAGGTGTGTGG + Intergenic
968838329 4:2981622-2981644 TTTTATAAGCTTCAGAGGGGAGG + Intronic
969376578 4:6767357-6767379 GTCTGAAATCTGCAGGTGGGGGG + Intergenic
970474735 4:16410778-16410800 GTATACAAGCTTAAGATGAGAGG - Intergenic
977537844 4:98276853-98276875 GTCTGAAATCTTCAGATGGCTGG + Intronic
979943919 4:126800803-126800825 GTCTATAAACTTCATATGGTAGG + Intergenic
980253607 4:130349280-130349302 TTTTATCAGCTTCAGATGGGAGG + Intergenic
980273674 4:130620352-130620374 GACTAAAAGTTTCACATGGCTGG + Intergenic
982856212 4:160385612-160385634 GTTTATGAGCTTCAGAGGGGAGG + Intergenic
983686724 4:170418721-170418743 ATTTAAAAGCTTCACATTGGGGG + Intergenic
987548704 5:19349184-19349206 TCCTAGAAGCTTCAGATGGAGGG + Intergenic
987871964 5:23631105-23631127 AAATAAAAGCTTCACATGGGTGG - Intergenic
989395327 5:40949693-40949715 TTCTATCAGCTTCAGAGGGGAGG - Intronic
991357346 5:65782668-65782690 GCCTACAATCTTCAGATGGTTGG - Intronic
991467491 5:66929140-66929162 GTCTGAAAGCCTCAGATGCAGGG + Intronic
991989410 5:72322634-72322656 GTTTAAAAACTTCAGATGATTGG + Intronic
995654610 5:114411476-114411498 GTCTAAAAGCCTCAGATCCAAGG + Intronic
995764432 5:115600729-115600751 GACAAAAAGCCTCAGATGAGAGG + Intronic
996362827 5:122669453-122669475 GACTAAAAACTTTAGATGGTTGG - Intergenic
996389000 5:122939886-122939908 GTTTAAAACCTTGAGATGTGTGG - Intronic
1001776878 5:174335571-174335593 CTCTAAAAGCTTAAGACAGGAGG - Intergenic
1003179631 6:3780643-3780665 GTCTAAAAGAGGCAGGTGGGAGG + Intergenic
1004758174 6:18636364-18636386 ATCTAAAGGCTGCAGATTGGAGG - Intergenic
1006885620 6:37379861-37379883 TTATAAAAGCATCAGATTGGTGG + Intronic
1009329177 6:62394252-62394274 GGCTAAGAGCTTCAGTTGTGAGG - Intergenic
1009508974 6:64523837-64523859 TTCTAAAGATTTCAGATGGGAGG - Intronic
1009762054 6:68020266-68020288 CTCTAAAAGCTTCAGTAGGCCGG + Intergenic
1021819631 7:24483678-24483700 TTCTAGAAGCATGAGATGGGAGG - Intergenic
1027028097 7:74869079-74869101 ATGTAAAAGATTCAGAGGGGTGG - Intergenic
1027059654 7:75074992-75075014 ATGTAAAAGATTCAGAGGGGTGG + Intergenic
1038765014 8:30419533-30419555 CTCAAAAAGCTTCAGATTGTGGG - Intronic
1038871905 8:31504196-31504218 GTCTAAAATGTTCATGTGGGAGG + Intergenic
1043517680 8:81010875-81010897 GTATAAAAGCTCCAGGTGAGGGG - Intronic
1046804389 8:118463776-118463798 GTCAAATGGCTTCAGCTGGGGGG + Intronic
1048873337 8:138816491-138816513 GTCTCTAAGCTGCTGATGGGTGG - Intronic
1050493565 9:6215613-6215635 GTTTAAAATATTCAGATGGAGGG + Intergenic
1050601593 9:7258332-7258354 TTCTTAAAGCTACAGATGGGAGG + Intergenic
1058499450 9:105595825-105595847 ATCTATAAGCTATAGATGGGAGG - Intronic
1188021835 X:25167283-25167305 GACTGTAAGCTTCAGAAGGGTGG + Intergenic
1189917950 X:45875548-45875570 GTATAAAAGCTTCTCATAGGAGG + Intergenic
1190774627 X:53542891-53542913 GTATAAAAAATTCAGATGGGTGG + Intronic
1191204795 X:57822344-57822366 GTCTAAAAGACTCAGGTGTGAGG - Intergenic
1193734880 X:85145626-85145648 GTCTACCAGCTTCAAATAGGTGG - Intergenic
1197100774 X:122651849-122651871 GAATAACAGCTTCATATGGGGGG + Intergenic
1199476923 X:148256135-148256157 ATCTAAAAGCATCAAATAGGAGG - Intergenic
1201336267 Y:12883734-12883756 GTACAAAATCCTCAGATGGGAGG - Intergenic
1201570305 Y:15406601-15406623 GTCTGAAAGCTACAACTGGGTGG + Intergenic