ID: 967904130

View in Genome Browser
Species Human (GRCh38)
Location 3:194486892-194486914
Sequence CTACGTCGCTGGCGGCGGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 68}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967904130_967904149 20 Left 967904130 3:194486892-194486914 CCCCCCCGCCGCCAGCGACGTAG 0: 1
1: 0
2: 1
3: 5
4: 68
Right 967904149 3:194486935-194486957 GGCGGCGCCCGATCACGCTGCGG 0: 1
1: 0
2: 0
3: 4
4: 38
967904130_967904151 22 Left 967904130 3:194486892-194486914 CCCCCCCGCCGCCAGCGACGTAG 0: 1
1: 0
2: 1
3: 5
4: 68
Right 967904151 3:194486937-194486959 CGGCGCCCGATCACGCTGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 18
967904130_967904139 2 Left 967904130 3:194486892-194486914 CCCCCCCGCCGCCAGCGACGTAG 0: 1
1: 0
2: 1
3: 5
4: 68
Right 967904139 3:194486917-194486939 AACCCCCCTCCCCTCCGCGGCGG 0: 1
1: 0
2: 0
3: 29
4: 237
967904130_967904150 21 Left 967904130 3:194486892-194486914 CCCCCCCGCCGCCAGCGACGTAG 0: 1
1: 0
2: 1
3: 5
4: 68
Right 967904150 3:194486936-194486958 GCGGCGCCCGATCACGCTGCGGG 0: 1
1: 0
2: 0
3: 5
4: 38
967904130_967904154 30 Left 967904130 3:194486892-194486914 CCCCCCCGCCGCCAGCGACGTAG 0: 1
1: 0
2: 1
3: 5
4: 68
Right 967904154 3:194486945-194486967 GATCACGCTGCGGGGAGAGCCGG 0: 1
1: 0
2: 0
3: 6
4: 121
967904130_967904138 -1 Left 967904130 3:194486892-194486914 CCCCCCCGCCGCCAGCGACGTAG 0: 1
1: 0
2: 1
3: 5
4: 68
Right 967904138 3:194486914-194486936 GAGAACCCCCCTCCCCTCCGCGG 0: 1
1: 0
2: 0
3: 23
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967904130 Original CRISPR CTACGTCGCTGGCGGCGGGG GGG (reversed) Intronic
900494934 1:2972031-2972053 CTCCTTCTCTGGCGGGGGGGGGG + Intergenic
901577167 1:10210460-10210482 GTCCGTCGCGGGCGCCGGGGCGG + Intergenic
903179491 1:21598088-21598110 CCACCTCACTGGCCGCGGGGAGG + Intronic
909392971 1:75136637-75136659 CTACAGCCCTGGCGGCCGGGAGG + Exonic
915441973 1:155951058-155951080 CTACGGCGCTGCCGGCGGCTAGG - Exonic
917954767 1:180083820-180083842 GTATGTGGCGGGCGGCGGGGAGG + Intronic
924439469 1:244074267-244074289 CTGGGTGGCTGGCGGCAGGGTGG + Intergenic
1068955276 10:62815326-62815348 CAACTTCGCGGGCGGCGGGCAGG + Intronic
1069769485 10:70888364-70888386 CTCTGTCGCTGGCGGCGGGGAGG - Intronic
1077052998 11:576077-576099 CTACGTGCGTGGGGGCGGGGTGG + Intergenic
1081938135 11:46918590-46918612 CTGCGGCGCGGGGGGCGGGGCGG - Exonic
1083670870 11:64299422-64299444 CTCCTTCTCCGGCGGCGGGGCGG - Exonic
1083992865 11:66257712-66257734 CTACCTCGGTGGCGTCGGAGGGG - Intronic
1084182573 11:67454224-67454246 CTTCCCCGCTGGCAGCGGGGAGG + Intronic
1086953758 11:92915584-92915606 CTTCGTGGCAGGCGGCTGGGCGG + Intergenic
1101148262 12:101862214-101862236 CTACTTGGCTGGGGGCTGGGGGG - Intergenic
1101592772 12:106138799-106138821 CTCGGTCACTGGCGGCGGCGGGG + Exonic
1105539004 13:21298308-21298330 CTGCGGCGCAGGCGGCGGGTCGG + Intergenic
1106137330 13:26983476-26983498 CTACGTCACTGGAGTCTGGGAGG + Intergenic
1106452425 13:29895052-29895074 CTACTTGGCGGGGGGCGGGGGGG + Intergenic
1108292690 13:48976548-48976570 CTACGCGGCTCGCCGCGGGGAGG - Intronic
1116452831 14:45083971-45083993 CGCCCTCGCTCGCGGCGGGGCGG + Intergenic
1122066352 14:99176414-99176436 GTAAGTCGCTGGCGCCCGGGTGG - Intronic
1122620962 14:103057473-103057495 CTGCGGCGGCGGCGGCGGGGAGG - Intergenic
1127988744 15:64095851-64095873 CTTAGGCGCTGGGGGCGGGGCGG - Intronic
1132490654 16:228913-228935 CCAGGTCGCTGGCAGCCGGGTGG - Intronic
1138533394 16:57647046-57647068 CTACATCCCTGGCGCCTGGGTGG + Intronic
1203070916 16_KI270728v1_random:1073773-1073795 CAGCGGCGGTGGCGGCGGGGGGG + Intergenic
1142623750 17:1179981-1180003 CAACTTCGCGGGGGGCGGGGCGG + Intronic
1143137008 17:4717675-4717697 CTACGCCGCAGGCCTCGGGGAGG - Exonic
1143371637 17:6444239-6444261 CCACGAGGCTGGCGGCGGGGCGG + Intergenic
1146416238 17:32635684-32635706 CTCCGTCTCGGGTGGCGGGGGGG + Intronic
1147195676 17:38765117-38765139 CTACACAGCTGGAGGCGGGGGGG + Intergenic
1148783915 17:50135945-50135967 GTACGTGGCTGGGGGCTGGGCGG - Intronic
1158137519 18:54223995-54224017 GTACCTCCCTGGGGGCGGGGAGG - Intronic
1158649416 18:59272937-59272959 CGCCGGGGCTGGCGGCGGGGAGG + Exonic
1160454847 18:78992959-78992981 CTGCGGCGCTGGCGCCGGGGCGG - Exonic
1161729050 19:5947733-5947755 CCACGTCCCTGCCGGCGGGGTGG + Intronic
1165668660 19:37655792-37655814 AGGCGTCGCTGGGGGCGGGGCGG - Intronic
928186608 2:29115832-29115854 CGGTGTCGCTGGCCGCGGGGAGG + Intronic
948480792 2:238249064-238249086 CCACGTCGATGGCTGCGGGCAGG + Exonic
1172195755 20:33090436-33090458 CTACGTTGGTGGGGGCAGGGGGG - Intronic
1176062640 20:63178995-63179017 CCGCGGTGCTGGCGGCGGGGCGG + Intergenic
1176649280 21:9530573-9530595 CTACAATGCTGGCGGGGGGGTGG + Intergenic
1178015619 21:28343093-28343115 CTGCATGGCTGGCAGCGGGGTGG + Intergenic
1181026612 22:20131127-20131149 CGACGGCGCTGTGGGCGGGGTGG - Intronic
1185313725 22:50170183-50170205 CTGCGTGGCGGGGGGCGGGGTGG + Intergenic
955001379 3:54930728-54930750 CTACCTCGCCGGAGGCAGGGAGG + Intronic
967904130 3:194486892-194486914 CTACGTCGCTGGCGGCGGGGGGG - Intronic
973199593 4:47485215-47485237 CTACGTCACGGAGGGCGGGGCGG + Intergenic
977685073 4:99838087-99838109 CTACGTGGCTGGCAGGGGGATGG + Intronic
985555303 5:555196-555218 CTTCCTCGCGGGCGCCGGGGCGG + Intergenic
985611377 5:891534-891556 CTGCGTGGCTGGAGGAGGGGAGG - Intronic
998938666 5:147257239-147257261 CTACGTCGGGGGCGGGGCGGGGG + Intronic
1001934665 5:175695650-175695672 CGATGTCGCTGGCAGCAGGGAGG - Intergenic
1004660732 6:17706829-17706851 CGACGACGACGGCGGCGGGGCGG - Exonic
1011983851 6:93418685-93418707 CTGCGTCGGAGGCGGCGGCGCGG - Intronic
1013170790 6:107634941-107634963 CTGGGTCGCCGGCGGCGGGCGGG - Exonic
1015541413 6:134317796-134317818 CCAGGTAGCTGGGGGCGGGGAGG - Exonic
1018743061 6:166744759-166744781 CCACGTCCCTGGCGGCGGTGGGG + Intronic
1022943746 7:35262101-35262123 CGGTGTCGCTGGCGGCGGCGGGG + Intergenic
1027233033 7:76282896-76282918 CGACGGGGCGGGCGGCGGGGTGG + Intronic
1035391323 7:158506805-158506827 CTATGGCGATGGCGGAGGGGCGG - Intronic
1049488108 8:142876874-142876896 CCAAGTTGCTGGCTGCGGGGAGG + Exonic
1049492994 8:142914897-142914919 CTAAGTTGCTGGCTGCGGGGAGG + Exonic
1050744256 9:8858138-8858160 CTCCGCCGCTCGCGGCTGGGGGG + Intronic
1054250416 9:62711503-62711525 CTACGGCGCTGACCGCGCGGAGG + Intergenic
1060969576 9:127730472-127730494 CTGGGTCGCTGGGGGCTGGGCGG + Intronic
1061929791 9:133826635-133826657 CTAGGTGGCTGGGGGAGGGGTGG - Intronic
1062022556 9:134326350-134326372 CTGCGGCGCCGGCGGGGGGGTGG - Intronic
1062379579 9:136280792-136280814 CTCCTTGGCTGGCAGCGGGGAGG - Intergenic
1203627021 Un_KI270750v1:34121-34143 CTACAATGCTGGCGGGGGGGTGG + Intergenic
1185503974 X:618952-618974 CTGCGTGGCTGGGGGCGTGGGGG + Intergenic
1189324663 X:40105330-40105352 CTGCGGCGGCGGCGGCGGGGCGG - Intronic
1195649752 X:107272611-107272633 CTACGACTATGACGGCGGGGAGG + Intergenic