ID: 967904138

View in Genome Browser
Species Human (GRCh38)
Location 3:194486914-194486936
Sequence GAGAACCCCCCTCCCCTCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 197}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967904133_967904138 -4 Left 967904133 3:194486895-194486917 CCCCGCCGCCAGCGACGTAGAGA 0: 1
1: 0
2: 0
3: 1
4: 23
Right 967904138 3:194486914-194486936 GAGAACCCCCCTCCCCTCCGCGG 0: 1
1: 0
2: 0
3: 23
4: 197
967904135_967904138 -6 Left 967904135 3:194486897-194486919 CCGCCGCCAGCGACGTAGAGAAC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 967904138 3:194486914-194486936 GAGAACCCCCCTCCCCTCCGCGG 0: 1
1: 0
2: 0
3: 23
4: 197
967904129_967904138 8 Left 967904129 3:194486883-194486905 CCGAAACGGCCCCCCCGCCGCCA 0: 1
1: 0
2: 1
3: 9
4: 160
Right 967904138 3:194486914-194486936 GAGAACCCCCCTCCCCTCCGCGG 0: 1
1: 0
2: 0
3: 23
4: 197
967904136_967904138 -9 Left 967904136 3:194486900-194486922 CCGCCAGCGACGTAGAGAACCCC 0: 1
1: 0
2: 1
3: 3
4: 31
Right 967904138 3:194486914-194486936 GAGAACCCCCCTCCCCTCCGCGG 0: 1
1: 0
2: 0
3: 23
4: 197
967904131_967904138 -2 Left 967904131 3:194486893-194486915 CCCCCCGCCGCCAGCGACGTAGA 0: 1
1: 0
2: 0
3: 1
4: 38
Right 967904138 3:194486914-194486936 GAGAACCCCCCTCCCCTCCGCGG 0: 1
1: 0
2: 0
3: 23
4: 197
967904130_967904138 -1 Left 967904130 3:194486892-194486914 CCCCCCCGCCGCCAGCGACGTAG 0: 1
1: 0
2: 1
3: 5
4: 68
Right 967904138 3:194486914-194486936 GAGAACCCCCCTCCCCTCCGCGG 0: 1
1: 0
2: 0
3: 23
4: 197
967904134_967904138 -5 Left 967904134 3:194486896-194486918 CCCGCCGCCAGCGACGTAGAGAA 0: 1
1: 0
2: 0
3: 2
4: 36
Right 967904138 3:194486914-194486936 GAGAACCCCCCTCCCCTCCGCGG 0: 1
1: 0
2: 0
3: 23
4: 197
967904132_967904138 -3 Left 967904132 3:194486894-194486916 CCCCCGCCGCCAGCGACGTAGAG 0: 1
1: 0
2: 1
3: 3
4: 57
Right 967904138 3:194486914-194486936 GAGAACCCCCCTCCCCTCCGCGG 0: 1
1: 0
2: 0
3: 23
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967904138 Original CRISPR GAGAACCCCCCTCCCCTCCG CGG Intronic
900184248 1:1325510-1325532 CAGCACGCCCCTCCCCTCCTCGG - Intronic
900402153 1:2476963-2476985 GAGATCCCCCCTCGCCCCCTTGG - Intronic
900623687 1:3598713-3598735 GAGCCCCCCCCCCCCCCCCGGGG + Intronic
901434864 1:9241111-9241133 GTGAACCTCCCTCCTCTCCTGGG - Intronic
901799731 1:11701104-11701126 GATAAGCCCCTTCCCCTCCCTGG + Intronic
902378530 1:16041783-16041805 CAGAGCCTCCCTCCCCTCCTAGG + Intergenic
904039369 1:27575406-27575428 GAGAGCACCCCTCGCCTCCTCGG - Intronic
905353090 1:37360864-37360886 GAGAAACCCCATTCCCTCCCTGG + Intergenic
906065104 1:42975039-42975061 GAGCACCCTCTTCCCCTCCCTGG - Intergenic
907659451 1:56378445-56378467 GTGAAAGCCCCTCCCCTCCCGGG - Intergenic
909194941 1:72607416-72607438 GAGAATCCCCTTCCCTTCCCAGG + Intergenic
910771476 1:90836123-90836145 GAGAACTCGCCTCCCCGCCCCGG + Intergenic
911091327 1:94019544-94019566 CAGCGCCTCCCTCCCCTCCGTGG - Intronic
914985915 1:152457101-152457123 GACCACCTCCCTCCCCTCCGGGG + Intergenic
915642714 1:157241585-157241607 GAGAACCCCCTTCCCTTTCCAGG + Intergenic
918493204 1:185105205-185105227 AAGATCCCCCCACCCCGCCGTGG - Intergenic
922802738 1:228371685-228371707 GAGCACCCCCCGCCCCTCCTCGG + Exonic
1063102707 10:2964287-2964309 GAGAACCCCCTTCCCTTTCCAGG + Intergenic
1065265577 10:23971739-23971761 GAGAATCCCCTTCCCTTCCCAGG + Intronic
1065689756 10:28321018-28321040 GAGAAGCTTCCTCCCCACCGGGG + Intronic
1067576100 10:47409573-47409595 GAGAGCTCCCCTCCCCCTCGGGG + Intergenic
1069770196 10:70893685-70893707 GAGAACCCCCCTACCCTTGGGGG + Intergenic
1070781076 10:79137819-79137841 GAGCACCCCCCCCCCAGCCGAGG - Intronic
1073051864 10:100672259-100672281 GAGAACACCTCTCCCCTTTGTGG + Intergenic
1073154464 10:101335498-101335520 CAGAACCACCCTCCCTTCCATGG - Intergenic
1076306152 10:129467048-129467070 GGGAACACCCCGCCCCTCCCGGG + Intergenic
1077207439 11:1351839-1351861 CAGACCCCCACTCCCCTCCTAGG + Intergenic
1077409701 11:2397976-2397998 GAGAATCCCCCTCCCTTTCCAGG - Intergenic
1078659944 11:13278242-13278264 GAGTACCCACCGCCCTTCCGCGG + Intronic
1080386985 11:31816194-31816216 GGGAACCCAACGCCCCTCCGGGG - Intronic
1083270371 11:61569258-61569280 CACAACCCCCCTGCCCTCTGTGG - Intronic
1083560479 11:63669706-63669728 GTGAACCACCCTCCTCTCCTCGG - Intronic
1084575353 11:69985335-69985357 GCCCACCCCCCTCCCCTCCCCGG - Intergenic
1084694510 11:70745607-70745629 GAGAGCCCCAATCCTCTCCGGGG + Intronic
1085387550 11:76165570-76165592 GAGAACCCATCTCCACTCCCCGG - Intergenic
1088330491 11:108645827-108645849 GAGATCATCCCTCCCCTCTGTGG - Intergenic
1089689971 11:120181033-120181055 CAGCACCTCCCTCCCCTCCAGGG - Intronic
1090203747 11:124873727-124873749 CAGAACCCAGTTCCCCTCCGGGG + Exonic
1090352539 11:126116372-126116394 GAGCACCCCCCACCCCCCCCGGG - Intergenic
1090699407 11:129280018-129280040 GCAAAGCCCCCTCTCCTCCGCGG - Intergenic
1091238565 11:134037389-134037411 GCCCACCGCCCTCCCCTCCGCGG - Intergenic
1093639654 12:21511479-21511501 CACAGCCCCCCTCCCCTTCGTGG + Intronic
1096681634 12:53259316-53259338 GAACAGCCCCCTCCCCTCCCAGG - Intergenic
1100488950 12:95059471-95059493 GTGATCCACCCTCCCCTCCTTGG - Intronic
1100734602 12:97512873-97512895 GAGCCTCCCCCTCGCCTCCGTGG - Intergenic
1103943921 12:124516056-124516078 GAGAACCCCCCCGCCTTCGGAGG + Intronic
1104089467 12:125503210-125503232 GCGCAGCCCCCTCCCCTCCCCGG + Intronic
1104694776 12:130854887-130854909 GAGAATCCCCTTCCCCTCCTGGG - Intergenic
1104946073 12:132415416-132415438 GTGTACCCCCCTCCCCACCCCGG + Intergenic
1104957945 12:132475142-132475164 GTGACCCCGCCCCCCCTCCGCGG + Intergenic
1105418112 13:20231008-20231030 CAGAACCCCCCTCTCCTCCTTGG + Intronic
1107467655 13:40665183-40665205 GAGAACCCGCCCTCCCCCCGCGG + Intronic
1109342539 13:61079449-61079471 GAGAACCCCCTTCCCTTTCCAGG + Intergenic
1111934626 13:94546602-94546624 GAGAGCCCCCCTCCCCACCAAGG + Intergenic
1113208157 13:107941652-107941674 GGGAAACCCTCTCCCCTCCAGGG + Intergenic
1119428259 14:74549993-74550015 GACCACCCCCCTTCCCTCCCAGG + Intronic
1122301668 14:100734626-100734648 GAAAACCCCTCTCCTCACCGAGG + Exonic
1122349439 14:101078902-101078924 GAGACCCCACCTCCCCTGCTGGG + Intergenic
1122630575 14:103105922-103105944 GACAAGCCACCTCCCCTCTGTGG + Intronic
1122848024 14:104511302-104511324 CAGAACCCCCCTCGCCACCCGGG + Intronic
1123023960 14:105414952-105414974 GGGATCCCCACTCCCCTCCCAGG - Intronic
1124208842 15:27745657-27745679 GAGAATCCCCCTTCCCTTCCAGG + Intergenic
1124345156 15:28917337-28917359 GAGAAACCTGCTCCCCTCCAGGG + Intronic
1124562074 15:30783282-30783304 GAGACCCCCTCTCCCCTCGGTGG - Intergenic
1124597572 15:31103250-31103272 GAGAACACCCCTCCTCCCCAGGG + Intronic
1126817316 15:52466590-52466612 TAGAACCACCCTCCCTTCCCAGG + Intronic
1128184198 15:65630479-65630501 GAGAACCCCCCCTGCCTCTGTGG + Intronic
1128444356 15:67743881-67743903 CAGAAGCCCCCTCCCTTCAGTGG - Intronic
1128648435 15:69393654-69393676 GAGAACCACCTTCCCCTCCAGGG + Intronic
1129153404 15:73703105-73703127 CAGAACCCCCCTCCCCCAAGGGG - Intronic
1129225992 15:74170805-74170827 GTGAGCCCCCCTCCCCTGCTAGG + Intergenic
1129273298 15:74430668-74430690 GAAACTCCCCCTCTCCTCCGGGG + Intronic
1129520255 15:76181389-76181411 GAGAGACCTCCTCCCCTCCCGGG - Intronic
1129738848 15:77980134-77980156 GAGCACACCCCTCCCCACAGCGG - Intergenic
1129902208 15:79159690-79159712 GATTACCCCCCTCCCCTCATGGG - Intergenic
1130254789 15:82320843-82320865 GAGCACACCCCTCCCCACAGTGG - Intergenic
1130600184 15:85269163-85269185 GAGCACACCCCTCCCCACAGTGG + Intergenic
1133225684 16:4339224-4339246 GAGCACCCCCCACCCCTGTGAGG + Exonic
1133596896 16:7302502-7302524 GAGAGCCCCCATCCCCTCTCAGG + Intronic
1134001886 16:10789261-10789283 GAGAACCCCCTTCCCTTTCCAGG - Intronic
1134078502 16:11308837-11308859 GAAGACCCCCCTCCCCTCACAGG - Intronic
1134748480 16:16606608-16606630 GATATGCCCCCTCCCCTCCTTGG + Intergenic
1134996984 16:18747008-18747030 GATATGCCCCCTCCCCTCCTTGG - Intergenic
1135821727 16:25691908-25691930 GCGCACCCCCCTTCCCTCGGCGG + Intergenic
1138179141 16:54930652-54930674 TAGCGCCCGCCTCCCCTCCGCGG - Intergenic
1139753100 16:69121038-69121060 GAAAAGCCCCCTCACCTCAGTGG + Exonic
1139921482 16:70463307-70463329 GAGAACCTCCCTCCCCTTCCTGG + Intronic
1140256142 16:73337886-73337908 GAGGACCCCCCCCCCCGCCAAGG - Intergenic
1141676029 16:85517926-85517948 GAGCGCCCCTCTCCCCTCCAAGG + Intergenic
1141986334 16:87582733-87582755 GGGGTTCCCCCTCCCCTCCGAGG + Intergenic
1142002546 16:87671747-87671769 GAGAACCCCCTTCCTCCCTGAGG + Intronic
1142144252 16:88486204-88486226 GAGACCCCCCAGCCCCACCGAGG - Intronic
1142558964 17:798766-798788 GAGAACCCACCTTTCCTCCGAGG + Intergenic
1144144077 17:12380534-12380556 GAGAACCCCCTTCCCTTTCTAGG + Intergenic
1145032241 17:19513248-19513270 GAGAATCCCCCTCCCTTTCCAGG + Intronic
1145243979 17:21255765-21255787 GAGAATCCCCCTCCCTTTCTGGG - Intergenic
1146229394 17:31095053-31095075 AAGAGGCCCCCTCCCCTCCCCGG + Exonic
1146371498 17:32267428-32267450 GAGCCCCCCCCTCCCCCCCCAGG - Intronic
1146901900 17:36594053-36594075 GTGCACCACCCTCCCCTCTGAGG - Intronic
1148042530 17:44720113-44720135 GAAAACCACCCTCGCCTCTGTGG + Intronic
1149605386 17:57921249-57921271 GGGAACCCCCTTCCCCTCTCAGG + Intronic
1149760026 17:59220744-59220766 GGGGACCCCTCTCACCTCCGCGG - Exonic
1151564797 17:74892092-74892114 GAGAAGCCCCCTGCTCCCCGGGG - Intronic
1151784900 17:76270587-76270609 GGGAAACCCCCTGCCCTCCCCGG - Exonic
1153222539 18:2874483-2874505 AAGCAGCCCCCTCCCCTCCTTGG + Intronic
1155312294 18:24535584-24535606 TAAAACCCCCCTCACCTCCTGGG - Intergenic
1155925503 18:31651393-31651415 GAGAGCCCCCCACCCCACCCTGG - Intronic
1158648759 18:59268912-59268934 GACAACCCCCCTCCCCAGCTCGG - Exonic
1161270056 19:3384852-3384874 GAGAACCTCCGTCCCCACGGTGG - Intronic
1161722263 19:5909666-5909688 GTGAAACCCCCTCCCCTCCCCGG - Exonic
1164674534 19:30092726-30092748 ATGAACACCCCTCCCCTCTGAGG - Intergenic
1165079669 19:33300158-33300180 GAGAACCCCCCTCACCTCATTGG + Exonic
1165895820 19:39140257-39140279 CAGAACCCATCTCCCCTCTGTGG - Intronic
1166044589 19:40222576-40222598 GAGAGCCCCCGACCCGTCCGTGG - Exonic
1166798703 19:45443428-45443450 AAGAACACCCCTCCCCACCTTGG + Intronic
1167427921 19:49439056-49439078 GTAAATCCCCCTCCCCTCCCTGG + Intronic
1168137813 19:54363198-54363220 GACAGCCCCTCTCCCCTCCGTGG - Intronic
1168160209 19:54505435-54505457 GACAGCCCTTCTCCCCTCCGTGG + Intronic
925723562 2:6851629-6851651 GAGACCCCCACTCACCTCAGTGG + Exonic
927974280 2:27326473-27326495 GAGAGCCCCCCTGCCCGCAGGGG + Exonic
929851140 2:45591694-45591716 GAGAGCCCCCCTCCCCAACTAGG + Intronic
929966692 2:46542454-46542476 GACTCCCCTCCTCCCCTCCGCGG + Intronic
931321989 2:61180711-61180733 CAGAGCCTCCCTCCCCTCCGTGG + Intronic
934517569 2:94998351-94998373 GAAAGTCCCCCTCCCCTCCCAGG - Intergenic
938079421 2:128361751-128361773 GAGGACCCTCCTCACCTCCCAGG - Intergenic
946171485 2:217898484-217898506 GAGATGCCCCCTCCCCTGAGAGG - Intronic
946220042 2:218217841-218217863 GAGTAGCCCCCTGCCCTCTGGGG + Intronic
946386447 2:219387160-219387182 GAGCATCCCCCTCCCCTAGGTGG - Exonic
947418649 2:229922268-229922290 GGGTCACCCCCTCCCCTCCGTGG + Intronic
948384986 2:237575646-237575668 GAGCACACCCCGCCCCTCCCTGG - Intronic
948524055 2:238559620-238559642 GTAAACCCCTCTCCCCTCCCAGG - Intergenic
949046185 2:241873612-241873634 GAGACCCCGCTTCACCTCCGAGG + Exonic
1168876060 20:1173127-1173149 GAGATCCCCACTCCTCTCTGAGG - Intronic
1168983649 20:2028698-2028720 GATTAGCCCCCTCCCCACCGAGG + Intergenic
1172037226 20:32018876-32018898 GAGACCCCCCCGCCCCGCCGAGG - Intronic
1172764938 20:37346258-37346280 GAGCGCCCCCCGCCCCTCCGCGG + Intronic
1173849230 20:46207415-46207437 CAGAATCCTCCTCCCCTCCCTGG + Intronic
1174421518 20:50402027-50402049 GAGCACCCCCCTCACCACCAAGG - Intergenic
1175142841 20:56873532-56873554 GAGAAGCTCCCTGCCCTCTGGGG + Intergenic
1175970213 20:62682514-62682536 GAGAGCCTCAGTCCCCTCCGTGG - Intronic
1176236806 20:64057215-64057237 GTGAACGTCCCTCTCCTCCGTGG + Intronic
1180083672 21:45497971-45497993 GAGATGCCCCCTCCCCTCCACGG + Intronic
1181533291 22:23529331-23529353 GAGACCCCTCCCCTCCTCCGAGG - Intergenic
1182475156 22:30573179-30573201 GACACCCCCCCTCGCCTCCCTGG - Intronic
1183087220 22:35493822-35493844 AAGCACCCCCCTCCCCACCCTGG + Intergenic
1183658815 22:39206633-39206655 CAGAACCCCCAGCCCCTCCCTGG - Intergenic
1184244726 22:43230262-43230284 CTGAACTCCCCTCCCCTCCTAGG + Intronic
1184531882 22:45061523-45061545 CAGAGCCCCCCTGGCCTCCGGGG + Intergenic
1185011640 22:48317863-48317885 AAGGACCCCCTTCCCCTCCTTGG + Intergenic
1185194226 22:49458792-49458814 GTGAACCCCCAGCCCCTGCGGGG + Intronic
1185376771 22:50486292-50486314 GAGAATCCCCCTACCCTCGAAGG + Exonic
951189311 3:19749764-19749786 GAGAACTCCCCTCACCACCTTGG - Intergenic
952033765 3:29175550-29175572 GAGAATCCCCTTCCCTTTCGAGG - Intergenic
953392254 3:42540503-42540525 GAGAGCCACCATCCCCTCCATGG + Intergenic
960925906 3:122794972-122794994 GGGGTCCGCCCTCCCCTCCGCGG - Exonic
962736431 3:138329591-138329613 GCGAAGCCCCCTCCCCACCCCGG + Intronic
967904138 3:194486914-194486936 GAGAACCCCCCTCCCCTCCGCGG + Intronic
967913660 3:194562390-194562412 AAGAAACCCCCTCCCTCCCGAGG + Intergenic
968911444 4:3478709-3478731 CAGAACCCACCTACCCTACGGGG - Intronic
971756796 4:30717927-30717949 GAGAAGCCGTCTCCACTCCGCGG - Intergenic
984277428 4:177627268-177627290 GAGAACCTTCCTCCTTTCCGGGG + Intergenic
985654593 5:1123333-1123355 GAGTGGCCCCCTCCCCTCCTCGG - Intergenic
985784547 5:1886998-1887020 GAGACCCCTCCCCCCTTCCGAGG - Exonic
985786905 5:1900794-1900816 CAGAACCACCATCCCATCCGTGG + Intergenic
991215926 5:64157418-64157440 GAAAAACCCCACCCCCTCCGTGG + Intergenic
999415089 5:151388067-151388089 GAGAACCCCCTTCCCTTTCTAGG + Intergenic
1002793604 6:452760-452782 GAGTGCCCCCCTCCCCTCCTTGG + Intergenic
1004241308 6:13924952-13924974 GGGAACCTCCCTCCCCTCCCAGG + Exonic
1005820702 6:29596347-29596369 GAGAATCCCCTTCCCCTTCCAGG + Intronic
1006080022 6:31559655-31559677 GAGCCCCCCTCTCTCCTCCGTGG - Intergenic
1006213132 6:32414399-32414421 GAGCACCACCCTCCCCTCACTGG - Intergenic
1006282875 6:33069359-33069381 GAGGACCACCCTCCCCTAAGAGG - Intronic
1006756804 6:36423367-36423389 GAGAACCCCGCTCCCGCCCTAGG + Intronic
1007263352 6:40579164-40579186 GGGAACCACCCTCTCCTCCAGGG + Intronic
1007753281 6:44082921-44082943 CAGAACCCCCCACCCCTCCTCGG + Intergenic
1013117567 6:107114770-107114792 GCGAACCCCCCGCCCCCGCGCGG + Intronic
1014242726 6:119035549-119035571 GAGAATCCCCCTCCCTTTCCAGG + Intronic
1017781860 6:157721617-157721639 GGGAACCCTCTTCCCCACCGCGG + Intronic
1018837319 6:167494704-167494726 AAGAACTCCCCTCTCCTCCGGGG - Intergenic
1019020201 6:168911651-168911673 GAGGACCCCGCTCCCCACCCGGG - Intergenic
1019265034 7:110385-110407 GAGATCTCCCCTCCGCCCCGTGG + Intergenic
1019267859 7:128838-128860 GAGGACGACCCTGCCCTCCGAGG - Intergenic
1024279956 7:47710626-47710648 GAGAAACCCCCTCCCCAACGCGG + Intronic
1025035723 7:55591555-55591577 GAGAAGCCCCTTCCCCTGGGAGG + Intergenic
1025249300 7:57341436-57341458 GAGCACCCCCCTCACCACCAAGG + Intergenic
1026086359 7:67266425-67266447 GAGAATCCCCTTCCCCTTCCAGG + Intergenic
1028086591 7:86644494-86644516 AAGAGCTCCCCTCCCCTCCGCGG + Exonic
1029688315 7:102164113-102164135 GTGAAACCCCGTCCCGTCCGGGG + Intronic
1030033560 7:105389205-105389227 GGGACCCTCCCTCCCCGCCGCGG + Intronic
1032268328 7:130383499-130383521 GAGAGCCCTCCTCACCTCCCCGG - Intronic
1035274328 7:157738305-157738327 CAGCACCTCCCTCCCCTCTGGGG - Intronic
1035443888 7:158926432-158926454 GAGAACCCCACTCTCATCCAAGG - Exonic
1035637109 8:1155656-1155678 GAGACCCCCAGGCCCCTCCGAGG + Intergenic
1035705297 8:1670322-1670344 CAGGACCCCACACCCCTCCGTGG + Intronic
1038003507 8:23410510-23410532 GAGAACTCCCGCCTCCTCCGAGG + Intronic
1046121690 8:109855596-109855618 GAGAATCCCCCTCCCTTTCCAGG + Intergenic
1047732402 8:127737790-127737812 GTGAACCCCGCTCCGCGCCGGGG - Intronic
1049014205 8:139908106-139908128 GAGCCCTCCCCTCCCCTCCCAGG - Intronic
1049509865 8:143022017-143022039 GGGAACCCTCGTCCCTTCCGCGG - Exonic
1053269461 9:36740152-36740174 GAAAATCCCCTTCCCCTCCCTGG + Intergenic
1055513388 9:77016139-77016161 GCGCGCCCCCCTCCCCACCGCGG + Intergenic
1056932325 9:90889531-90889553 GAGACCTCCCCTCCCCACCCTGG + Intronic
1057439958 9:95075932-95075954 GAGAGCCCCCATCCCCATCGGGG - Intronic
1058820281 9:108723174-108723196 GGTAACCCCCCTTCCCTCCAAGG + Intergenic
1060516485 9:124269327-124269349 GAAAACCCCCCACCCCTGCCTGG + Intronic
1060944154 9:127560091-127560113 GAGAACCTTCTTCCCCTCCAAGG - Intronic
1061189140 9:129071552-129071574 GAGAAACACACTCCCCTCCTGGG + Exonic
1061482410 9:130903526-130903548 GAGAACCCACCTCTCCCCCAAGG - Exonic
1061537037 9:131256701-131256723 GTGCACCCCCCTCCCCACCCCGG - Intergenic
1061906954 9:133703843-133703865 GAGTACCCCCCTCCCCAGCAGGG + Intronic
1062146442 9:134992271-134992293 AAGGACCCCCCTCCCCGCGGAGG + Intergenic
1062207232 9:135343907-135343929 GAAATGCCCCCTCCCCTCTGTGG - Intronic
1062596924 9:137303699-137303721 GAGCACCCCTCCACCCTCCGTGG - Intergenic
1186220393 X:7343754-7343776 CAGCACCCCCCGCCCCTCCCGGG + Intronic
1187266429 X:17737825-17737847 AAGCACCCCCCTCCACACCGCGG - Intronic
1190341850 X:49303423-49303445 CTAAACCCCCCTCCCCTCCAGGG - Intergenic
1190366139 X:49696205-49696227 CTGAGCCCCCCTCCCCTCCAGGG + Intergenic
1192758036 X:74066530-74066552 GAGAGCCCCCCACCTCTCAGGGG - Intergenic
1193462957 X:81811591-81811613 AACAACCCCCCGACCCTCCGGGG - Intergenic
1196182120 X:112703810-112703832 GAGAACCCCACTACCCTGCTTGG + Intergenic
1199978051 X:152905834-152905856 GGGGACTCCCCTCCCCTCCAGGG + Intergenic