ID: 967904139

View in Genome Browser
Species Human (GRCh38)
Location 3:194486917-194486939
Sequence AACCCCCCTCCCCTCCGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 237}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967904131_967904139 1 Left 967904131 3:194486893-194486915 CCCCCCGCCGCCAGCGACGTAGA 0: 1
1: 0
2: 0
3: 1
4: 38
Right 967904139 3:194486917-194486939 AACCCCCCTCCCCTCCGCGGCGG 0: 1
1: 0
2: 0
3: 29
4: 237
967904135_967904139 -3 Left 967904135 3:194486897-194486919 CCGCCGCCAGCGACGTAGAGAAC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 967904139 3:194486917-194486939 AACCCCCCTCCCCTCCGCGGCGG 0: 1
1: 0
2: 0
3: 29
4: 237
967904137_967904139 -9 Left 967904137 3:194486903-194486925 CCAGCGACGTAGAGAACCCCCCT 0: 1
1: 0
2: 0
3: 2
4: 37
Right 967904139 3:194486917-194486939 AACCCCCCTCCCCTCCGCGGCGG 0: 1
1: 0
2: 0
3: 29
4: 237
967904134_967904139 -2 Left 967904134 3:194486896-194486918 CCCGCCGCCAGCGACGTAGAGAA 0: 1
1: 0
2: 0
3: 2
4: 36
Right 967904139 3:194486917-194486939 AACCCCCCTCCCCTCCGCGGCGG 0: 1
1: 0
2: 0
3: 29
4: 237
967904133_967904139 -1 Left 967904133 3:194486895-194486917 CCCCGCCGCCAGCGACGTAGAGA 0: 1
1: 0
2: 0
3: 1
4: 23
Right 967904139 3:194486917-194486939 AACCCCCCTCCCCTCCGCGGCGG 0: 1
1: 0
2: 0
3: 29
4: 237
967904130_967904139 2 Left 967904130 3:194486892-194486914 CCCCCCCGCCGCCAGCGACGTAG 0: 1
1: 0
2: 1
3: 5
4: 68
Right 967904139 3:194486917-194486939 AACCCCCCTCCCCTCCGCGGCGG 0: 1
1: 0
2: 0
3: 29
4: 237
967904132_967904139 0 Left 967904132 3:194486894-194486916 CCCCCGCCGCCAGCGACGTAGAG 0: 1
1: 0
2: 1
3: 3
4: 57
Right 967904139 3:194486917-194486939 AACCCCCCTCCCCTCCGCGGCGG 0: 1
1: 0
2: 0
3: 29
4: 237
967904129_967904139 11 Left 967904129 3:194486883-194486905 CCGAAACGGCCCCCCCGCCGCCA 0: 1
1: 0
2: 1
3: 9
4: 160
Right 967904139 3:194486917-194486939 AACCCCCCTCCCCTCCGCGGCGG 0: 1
1: 0
2: 0
3: 29
4: 237
967904136_967904139 -6 Left 967904136 3:194486900-194486922 CCGCCAGCGACGTAGAGAACCCC 0: 1
1: 0
2: 1
3: 3
4: 31
Right 967904139 3:194486917-194486939 AACCCCCCTCCCCTCCGCGGCGG 0: 1
1: 0
2: 0
3: 29
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967904139 Original CRISPR AACCCCCCTCCCCTCCGCGG CGG Intronic
900032555 1:381734-381756 ATCCGCCCACCCCACCGCGGCGG + Intergenic
900053312 1:610796-610818 ATCCGCCCACCCCACCGCGGCGG + Intergenic
900096771 1:942975-942997 AAGCCCCTTCCCCTCGGCGCCGG - Exonic
900173465 1:1281641-1281663 CACCCCCCTCCCCTCCTCCCGGG - Intronic
900798837 1:4725501-4725523 CACCCACCTCCCCTTCGAGGGGG + Intronic
901332685 1:8423511-8423533 AGCACCCCTCCCCGCCCCGGTGG + Intronic
903341421 1:22657141-22657163 AGCCCCACTCCCCTCCCCAGAGG + Intronic
903921607 1:26804042-26804064 CACCTCCCTCCCCGCCGGGGTGG + Intergenic
904056052 1:27670827-27670849 AGCCCCTCTCCCCTCCCCAGAGG + Intronic
905028549 1:34866792-34866814 AACCCCGCTCCCCCGCGCTGAGG + Intronic
906196482 1:43933590-43933612 TACCCCCCTCCCAACCTCGGGGG + Exonic
906359243 1:45138700-45138722 AGCCCCTCTCCCCTCCCCAGGGG + Intronic
906846750 1:49200866-49200888 AGCCCCTCTCCCCTCCCTGGAGG + Intronic
908131474 1:61080009-61080031 CTCCCCCCCTCCCTCCGCGGGGG + Intronic
908131835 1:61082365-61082387 ACACCCCCTCCCCCCCGCGGCGG + Intronic
909447051 1:75759291-75759313 AGCCCCTCTCCCCTCCCTGGAGG + Intronic
909542150 1:76803220-76803242 AACCCCTCTTCCCTCCCTGGAGG + Intergenic
910011711 1:82471863-82471885 AGCCCCTGTCCCCTCCGCAGAGG + Intergenic
912665880 1:111579158-111579180 ACCCTCCCTCCCCTCCTTGGAGG + Intronic
914847656 1:151291732-151291754 AACCCCCCACCCCCCCGCCCCGG - Exonic
917126675 1:171694026-171694048 AACCCTCCTCCCCTCCCAGACGG + Intergenic
919678703 1:200411686-200411708 AATCCCTCTCTCCTCCCCGGAGG - Intergenic
922250484 1:223845523-223845545 AAGCCCCGGCCCCTCCGCGCGGG + Intronic
922802739 1:228371688-228371710 CACCCCCCGCCCCTCCTCGGAGG + Exonic
924236112 1:242000843-242000865 AACCCCTCTACCCTCCCCAGAGG + Intergenic
1062767487 10:76541-76563 AAGCCCCGGCCCCTCCGGGGTGG + Intergenic
1064048901 10:12043185-12043207 AACACTCCACCCCTCCGCTGGGG - Intergenic
1066963773 10:42243005-42243027 CCCCCCCCTCCCCCCCGCCGAGG + Intergenic
1066986901 10:42475974-42475996 AACCCCCGCCCCCACCGCTGGGG - Intergenic
1069770197 10:70893688-70893710 AACCCCCCTACCCTTGGGGGAGG + Intergenic
1069832087 10:71287687-71287709 AACCCCGCTCCACTCAACGGAGG + Exonic
1070367336 10:75750260-75750282 CACCTCCCTCCCCGCCGGGGCGG + Intronic
1070469726 10:76766734-76766756 AGCCGCCCTCCCCTCCTCTGAGG + Intergenic
1075162891 10:120040282-120040304 AGCCCCCCTCCCCTCCCCAGAGG - Intergenic
1078088866 11:8251501-8251523 AACCACCCTCACCTCCTCTGCGG + Intronic
1079310791 11:19364048-19364070 AGCCCCTCTCCCCTCCCCAGAGG + Intronic
1080456901 11:32427009-32427031 ATCCTCCCTCCCCTCCGCGCGGG - Intronic
1083187652 11:61026928-61026950 ATCCCCCACCCCCTCCGCAGAGG + Intergenic
1084014800 11:66371927-66371949 GCCCCCCGTCCTCTCCGCGGGGG + Intronic
1084501865 11:69539898-69539920 GAGGCCCCTCCCCTCCACGGAGG + Intergenic
1085561263 11:77474200-77474222 ACTCCCCCTCCCCGGCGCGGCGG + Intronic
1086378121 11:86222168-86222190 AACCCCTCTCTCCTCCTTGGAGG + Intergenic
1087319225 11:96638553-96638575 ACCCCCCCGCCCCTCCGCCCGGG + Intergenic
1089834167 11:121355586-121355608 AGCCCCTCTCCCCTCCCCCGAGG - Intergenic
1091571540 12:1691145-1691167 CTCCCCCCTCCCCTCAGCGGTGG + Exonic
1092894887 12:13001441-13001463 CACCCCCCTCCCCACCCCCGCGG - Intergenic
1093383371 12:18521603-18521625 AACCCCCCACCCCTCCTGGCTGG - Intronic
1093639655 12:21511482-21511504 AGCCCCCCTCCCCTTCGTGGAGG + Intronic
1095981541 12:47977274-47977296 AGCCGCCTTCCCCTGCGCGGTGG - Intronic
1096117090 12:49060923-49060945 AGCCCCCCTCCTCTCCGCCGCGG + Intergenic
1096818599 12:54217074-54217096 ACCTCCCCGCCCCTCCTCGGTGG - Intergenic
1097028468 12:56075747-56075769 AACCTCCCTCCCCGACGGGGCGG + Intergenic
1098416112 12:70237164-70237186 ACCCCCTCTCCCCTCCCTGGAGG - Intergenic
1098962862 12:76757015-76757037 ATGCCCCCTCCCCTCCGAGACGG - Intergenic
1099956207 12:89354023-89354045 AACGCGCCTCCCCGCCGCCGCGG - Intergenic
1102146500 12:110658663-110658685 AGCCCCCCTCCTCCCTGCGGAGG + Intronic
1102466834 12:113135156-113135178 ACACCCCCTCCCCTGCCCGGGGG + Intronic
1103379340 12:120481725-120481747 AGCCCCACTCCCCTCCCTGGAGG + Intronic
1103428716 12:120862792-120862814 AACCCCTCTCCCCTCTGCAGAGG + Intronic
1104775036 12:131385927-131385949 AACCCCCGCCCCCTCCCCGAGGG + Intergenic
1106956310 13:34942625-34942647 ATCCCCCGCCGCCTCCGCGGGGG + Exonic
1107298592 13:38941320-38941342 AGCCCCTCTCCCCTCCCAGGAGG + Intergenic
1107467656 13:40665186-40665208 AACCCGCCCTCCCCCCGCGGAGG + Intronic
1111706928 13:91761859-91761881 AGCCCCTCTCCCCTCCCTGGAGG + Intronic
1114957817 14:27845699-27845721 CACCGCCCTCTGCTCCGCGGCGG + Intergenic
1115919858 14:38360497-38360519 ATCCCCTCTCCCCTCCCTGGAGG + Intergenic
1116363390 14:44029565-44029587 AACCCCTCTCCCCTCCACAAAGG + Intergenic
1118797101 14:69153290-69153312 GGCGCCCCTCCCCTCCGCGGGGG + Intergenic
1121118651 14:91361575-91361597 AACCCCCCTCCACTCAGTGCTGG + Intronic
1121624486 14:95374355-95374377 AGCCCCTGTCCCCTCCGCAGAGG + Intergenic
1122183555 14:99972132-99972154 AGCCCCCCTCCCGCCCTCGGGGG - Intronic
1124167737 15:27343084-27343106 AGCTCCCCTGCCCTTCGCGGTGG + Intronic
1124962454 15:34409086-34409108 CTCCCCCCTCCCCTCCCCAGAGG + Intronic
1124979078 15:34555308-34555330 CTCCCCCCTCCCCTCCCCAGAGG + Intronic
1126465960 15:48962282-48962304 AACCCAGCTCCCCTCCGCCTTGG + Intronic
1126763738 15:51993021-51993043 AACCTCTCTCCCCTCCCTGGAGG + Intronic
1127807496 15:62534644-62534666 AGCCCCGCTCCCCTCCTCTGAGG + Intronic
1128356831 15:66934041-66934063 AACCCACCTCCCCTCCCCAGAGG + Intergenic
1128612811 15:69087541-69087563 AAGCCCCCTCCCCTGTGCTGCGG - Intergenic
1128648436 15:69393657-69393679 AACCACCTTCCCCTCCAGGGAGG + Intronic
1129067778 15:72921988-72922010 AGCCCCTCTCCCCTCCCAGGAGG + Intergenic
1131426062 15:92346361-92346383 AGCCCCTCTCCCCTCCCTGGAGG - Intergenic
1132138450 15:99367866-99367888 AGCCCCCCTCCCCTCCCCAAAGG + Intronic
1132618498 16:853584-853606 TACCTCCCTCCCCTTGGCGGTGG - Intergenic
1134132152 16:11657247-11657269 GACCCCCTTCCCCACCGCGGTGG - Intergenic
1136114337 16:28085249-28085271 AGCCCCTCTCCCCTCCCCGGAGG - Intergenic
1136225564 16:28858087-28858109 AGGCCCCCTCCCCTCCCTGGGGG + Intronic
1141600567 16:85123817-85123839 AGCCCCCCTCCTCTCCCCAGTGG + Intergenic
1141663321 16:85453294-85453316 TACCTCCCTTCCCTCCGCGGAGG + Intergenic
1141978495 16:87534491-87534513 AGCCCCTCTCCCCTCCCTGGAGG + Intergenic
1143147424 17:4785775-4785797 ACCCCTCCTCCGCTCCTCGGCGG - Intronic
1143176770 17:4959960-4959982 AAACCCCCACCCCTCCCAGGTGG + Intronic
1143478805 17:7217361-7217383 AAGCCCCCTCCCCTCCACTGGGG - Intronic
1143625596 17:8108853-8108875 CACCCCCCTCCCCACCCAGGAGG + Intronic
1143811305 17:9473980-9474002 AGCCTCCCTCCCCTCCCTGGGGG - Intronic
1145976239 17:28985996-28986018 AACACCCCTCCCTTCCCCGCGGG + Intronic
1146417401 17:32648577-32648599 AGCCCCTCTCCCCTCCGTGAAGG - Intronic
1148090650 17:45020818-45020840 CACCCCCCACCCCTCAGGGGTGG + Intergenic
1148215483 17:45831852-45831874 AGGCCCCCTCCCCTCCATGGGGG - Intronic
1148389494 17:47260680-47260702 CACCACCCTCCCCTCCACTGGGG - Intronic
1149296282 17:55265043-55265065 CACCCCCCTCCCCGCGCCGGCGG - Exonic
1149698712 17:58637460-58637482 AGCCCCTCTCCCCTCCCCGGAGG - Intronic
1150675705 17:67244905-67244927 AGTCCCCTTCCCCTCCGCTGGGG - Intronic
1151215995 17:72576640-72576662 AACCTCCCTCCCCTCCCCTTAGG - Intergenic
1151313848 17:73310435-73310457 AAGCCCCCTGCCCTCCCCTGAGG - Intronic
1152512450 17:80799705-80799727 CACACCCCTCCCCTCCCTGGCGG + Intronic
1152627051 17:81392650-81392672 AACCAGCCTCCCCTCCCCCGTGG - Intergenic
1152947385 17:83205448-83205470 ATCCGCCCACCCCACCGCGGCGG - Intergenic
1152960322 18:75887-75909 AAGCCCCGGCCCCTCCGGGGTGG + Intergenic
1153509662 18:5838118-5838140 AGCCCCTCTCCCCTCCCCAGAGG - Intergenic
1153624574 18:7011939-7011961 AACCCCACTCCCCTGGGAGGTGG - Intronic
1153800090 18:8661131-8661153 AAGTCCCCTCCCCTCCGGGGCGG - Intergenic
1155397933 18:25406111-25406133 AGCCCCTCTCTCCTCCGTGGAGG + Intergenic
1155613990 18:27700724-27700746 AGCCCCTCTCCCCTCCCCAGAGG + Intergenic
1156273041 18:35554886-35554908 AGCCCCTCTCCCCTCCTTGGAGG + Intergenic
1157975660 18:52324098-52324120 AACCACCCTCCTCTCCCTGGAGG - Intergenic
1158438004 18:57447552-57447574 AATCCCCCGCCCCCCAGCGGTGG - Intronic
1158693412 18:59681977-59681999 AAGCCCCATCCCCTCCTCTGAGG + Intronic
1160265585 18:77338949-77338971 ATCCCCCCTCCCCTCCACCCAGG - Intergenic
1160734455 19:655875-655897 ATCCCCCCTCCCCCCCGCCGTGG - Intronic
1160960547 19:1718817-1718839 CGCCCCCCTGCTCTCCGCGGGGG + Intergenic
1160973763 19:1782302-1782324 AACCCTGGTCCCCTCCGCAGAGG + Exonic
1161315311 19:3614759-3614781 CCACCCCCTCCCCTCCGCTGTGG - Intronic
1163502571 19:17685814-17685836 GTCCCCCCTCCCCTCCACCGGGG - Intronic
1164941907 19:32257299-32257321 AACACCCATCTCCTCCACGGGGG + Intergenic
1167260358 19:48454551-48454573 CACCCCCATGCCCTCCGCTGGGG - Exonic
1167321624 19:48800149-48800171 AGCCCTCCTCCCCACCCCGGTGG + Intronic
1167960929 19:53103567-53103589 CACTCCCCACCCCTCCCCGGTGG - Intergenic
1168219399 19:54949707-54949729 AGCCCCTCTCCCCTCCCTGGAGG - Intronic
1168404194 19:56102430-56102452 GGCCTCCCTCCCCTCCACGGAGG - Intronic
926077421 2:9952096-9952118 CACCCTCCTCCCCTCCTCCGCGG + Intronic
927981990 2:27380246-27380268 AAGCCCCCTCCCCTCTTCAGTGG - Exonic
928557481 2:32442902-32442924 AAGACCCCTCCCCTCCCCAGTGG + Intronic
929033885 2:37672547-37672569 CGCGCCCCTCCCCTCCGCCGGGG + Intronic
929431454 2:41890802-41890824 AGCCCCTCTCCCCTCCCTGGAGG - Intergenic
930605201 2:53486333-53486355 AGCCCCCCTCCCCACCACGAGGG + Intergenic
931115719 2:59164598-59164620 AGCCCCTCTCCCCTCCCCAGAGG - Intergenic
931614611 2:64143923-64143945 AACTCCGCTCCCCGCCGCAGCGG + Intronic
932230426 2:70079364-70079386 ATCCTCCCTCCCCTCCTCAGTGG - Intergenic
935755312 2:106271956-106271978 AATCCTCCTCCCCTCCTTGGAGG + Intergenic
936151527 2:110024639-110024661 ATCCTCCTTCCCCACCGCGGCGG - Intergenic
936193147 2:110346730-110346752 ATCCTCCTTCCCCACCGCGGCGG + Intergenic
937287855 2:120764252-120764274 AACCTCCCTCCCCAGCACGGTGG - Intronic
940651032 2:156441006-156441028 AGCCCCTCTCCTCTCCCCGGAGG - Intronic
943731554 2:191308018-191308040 AGCTCCCCTCCCCTCCCTGGAGG + Intronic
944479007 2:200135962-200135984 AGCCCCTCTCCCCTCCCAGGAGG + Intergenic
946161030 2:217836159-217836181 AGCCCCCAGCCCCTCTGCGGAGG - Exonic
947658670 2:231850118-231850140 AGCCCCTCTCCCCTCCCTGGAGG - Intergenic
948524054 2:238559617-238559639 AACCCCTCTCCCCTCCCAGGTGG - Intergenic
1169053973 20:2604704-2604726 AGCCCCTCTCCCCTCCCTGGAGG - Intronic
1169232036 20:3896596-3896618 AAGCCCCCACCCCTCCCCAGAGG - Intronic
1172020207 20:31908585-31908607 AATCCCACTCCCCTTCGCTGGGG - Exonic
1172865093 20:38089833-38089855 AGCCCCCCTGCCCTCTGCTGGGG + Exonic
1173335905 20:42112351-42112373 AACCCCCCTCCCCTGGGGTGTGG + Intronic
1173867261 20:46320342-46320364 AACCCACCTCTCCTCCCTGGGGG + Intergenic
1174246811 20:49188047-49188069 CGCCCACCTCCCCACCGCGGCGG + Intronic
1174405986 20:50303777-50303799 ATCCACCCTCCCCTCCTCTGAGG - Intergenic
1174474144 20:50784003-50784025 TAACTCCCTCCCCTCCGGGGTGG - Intergenic
1174656858 20:52178891-52178913 AATCCTCCTCCCCTCCCCGAGGG + Intronic
1175096334 20:56544260-56544282 AGCCCCTCTCTCCTCCCCGGAGG - Intergenic
1176172153 20:63700939-63700961 ACCCCCCATCCCCTCCCTGGGGG + Intronic
1176668723 21:9712068-9712090 AACCCCTCTCCCCTCCCAGGAGG + Intergenic
1178342987 21:31801772-31801794 AACCCCTCTCCCCTTTGCTGAGG + Intergenic
1178967116 21:37131283-37131305 AGCCCCCCTCCTCTCCTTGGAGG - Intronic
1179024819 21:37671215-37671237 AACCCCCTTCCCTTCCCTGGAGG - Intronic
1179958150 21:44752398-44752420 AAGCCCCCTCCCCCCCGCCCGGG + Intergenic
1181332888 22:22107992-22108014 AGCCCCTCTCCCCTCCACAGAGG + Intergenic
1183449086 22:37881140-37881162 AACCCACCTCCCCTCCTGAGAGG - Intronic
1183678763 22:39314624-39314646 AACCCCACTCCCCATCACGGGGG + Intronic
1185272773 22:49936359-49936381 CACCCCCCGCCCCCCCGGGGTGG + Intergenic
1185394231 22:50578538-50578560 AACCCACCCACCTTCCGCGGTGG + Exonic
950140687 3:10613033-10613055 CAGCCCCCTCCCCTCGGTGGAGG - Intronic
952218907 3:31304662-31304684 AGCCCCTCTCCCCTCCCTGGAGG + Intergenic
953282131 3:41569254-41569276 AGCCCCTCTCCCCTCCCCAGAGG + Intronic
956458050 3:69443155-69443177 AGCCCCTCTCCCCTCCCTGGGGG - Intronic
959889133 3:111534261-111534283 AGGCCCCCTCCCCTCCTCAGAGG - Intronic
960009913 3:112822398-112822420 AGCCCCTCTCCCCTCCCAGGAGG - Intronic
960148747 3:114230889-114230911 AACCCCTCTTCCCTCAGCTGAGG + Intergenic
960738315 3:120804475-120804497 AGCCCCTCTCCCCTCCTGGGAGG + Intergenic
960937821 3:122913891-122913913 AACCCTGCTCCCCGCCACGGGGG - Exonic
964748522 3:160033753-160033775 AGCCCCCCTTCCCTCCTTGGAGG + Intergenic
967904139 3:194486917-194486939 AACCCCCCTCCCCTCCGCGGCGG + Intronic
968491583 4:893167-893189 TGCCTCCCTCCCCTCTGCGGGGG + Intronic
968491616 4:893287-893309 TGCCTCCCTCCCCTCTGCGGGGG + Intronic
968498539 4:932360-932382 TAGCCCCGTCCCCTCCGCCGCGG + Intronic
968541570 4:1170939-1170961 CAGCCCCGTCCCCACCGCGGGGG + Intronic
969113364 4:4857067-4857089 CCCCCCCCCCCCCCCCGCGGCGG + Intergenic
969507182 4:7595413-7595435 AACCCCTCTTCCCTCCCCAGAGG + Intronic
970473521 4:16400017-16400039 AAACCCCCTCCCTTCCCTGGAGG - Intergenic
971504724 4:27353760-27353782 GAACCCCCTCCCCTCCACTGTGG - Intergenic
975608824 4:76183705-76183727 AGCCCCTCTCCCCTCCTGGGAGG + Intronic
978807474 4:112815652-112815674 AGCCCCCCTCCCCTCTATGGAGG - Intergenic
980245152 4:130229350-130229372 AACCTCCATCCCTTCTGCGGTGG + Intergenic
980366521 4:131810327-131810349 AACCTCCCTCCCCTCCCGGCTGG - Intergenic
984721307 4:182975623-182975645 ACCCCCCCCACCTTCCGCGGTGG + Intergenic
985406059 4:189639457-189639479 AGCCCCTCTCCCCTCCCAGGAGG - Intergenic
985542223 5:492384-492406 GACCTCCCTCCCCTCCCCTGTGG - Intronic
985542253 5:492450-492472 GACCTCCCTCCCCTCCCCCGAGG - Intronic
985635365 5:1033209-1033231 GGCCTCCCTCCCCTCCGCAGGGG + Intronic
987675646 5:21069556-21069578 AGCCCCTCTCCCCTCCAAGGAGG - Intergenic
996571399 5:124935982-124936004 ACCCCCCCTTCCCTCCCCAGAGG + Intergenic
996642736 5:125776778-125776800 AACCCATCTCCCCTCCCCAGGGG + Intergenic
998386657 5:141760963-141760985 AACTCCCTTCCCTTCCGAGGGGG + Intergenic
999266566 5:150270586-150270608 ACCCCCCCTCCCCGCCCCCGAGG + Intronic
1002561987 5:180088780-180088802 AGCCCCTCTCCGCTCCCCGGAGG + Intergenic
1002741265 5:181437134-181437156 ATCCGCCCACCCCACCGCGGCGG - Intergenic
1003059367 6:2850869-2850891 AATCCCTCTCCCCTCTGCAGAGG + Intergenic
1003098027 6:3157375-3157397 AACCCCGGGCCCCTCCGTGGCGG + Intronic
1004285158 6:14314840-14314862 AACACCCCTCACCTAGGCGGGGG + Intergenic
1004461622 6:15842063-15842085 AGCCCCTCTCCCCTCCCCAGAGG + Intergenic
1004893906 6:20128081-20128103 AACCCCCCGCCCCTCCACCATGG + Intronic
1004906599 6:20242406-20242428 AGCCCCTCTCCCCTCCCTGGTGG + Intergenic
1006294414 6:33163706-33163728 AGCACCCCTCCCCGCCTCGGTGG + Exonic
1006589114 6:35141279-35141301 AACCCGCCGCTCCGCCGCGGTGG - Exonic
1006851550 6:37102456-37102478 GCCCTCCCTCCCCTCCACGGTGG + Intergenic
1007074347 6:39057380-39057402 AAGACCCCTCCCCTCCTCGGAGG - Intronic
1014110761 6:117616944-117616966 AACCCCCCCCCCCCCCCCGTGGG - Intergenic
1016779163 6:147939336-147939358 TAGCCCCCTCCCCTCCCTGGAGG + Intergenic
1016825571 6:148385612-148385634 AGCCCCTCTCCCCTCCCCAGAGG - Intronic
1018137117 6:160789262-160789284 AACCCCCCCCCCCGCCCCCGGGG - Intergenic
1019611725 7:1940129-1940151 AACCCCGCTTCCCTCTGCGGCGG - Intronic
1020009394 7:4800044-4800066 AACCCCACTCTCCTCCCCGAAGG + Intronic
1022837744 7:34133239-34133261 AGCCCCTCTCCCCTCCTTGGAGG - Intronic
1023299874 7:38758756-38758778 AGCCCCTCTCCCCTCCTTGGAGG - Intronic
1024279957 7:47710629-47710651 AAACCCCCTCCCCAACGCGGAGG + Intronic
1024735784 7:52302981-52303003 CACCCCCCTCCCCGCCACCGTGG - Intergenic
1025007656 7:55366544-55366566 CACCTCCCGCCCCTGCGCGGCGG + Intronic
1026317219 7:69237769-69237791 AACCCCTCTCCCCTGCCTGGAGG + Intergenic
1029036692 7:97529697-97529719 AGCCCCTCTCCCCTCCCTGGAGG + Intergenic
1032530438 7:132615399-132615421 AGCCCCCGTCCCCTCCGCCAGGG - Intronic
1033063879 7:138134367-138134389 AACCCCTCTCCCCTCCCTAGAGG - Intergenic
1034147368 7:148884632-148884654 TCCCCGCCTCCCGTCCGCGGCGG - Intergenic
1035501692 8:94858-94880 ATCCGCCCACCCCACCGCGGCGG + Intergenic
1036727337 8:11231588-11231610 AACTCCCCTCCCCACTGCTGGGG - Intergenic
1037441716 8:18923036-18923058 CACCCCTCTCCCCTCCCCAGAGG + Intronic
1038516051 8:28188471-28188493 CAGCCCCCTTCCCTCCCCGGAGG - Intronic
1039330686 8:36533603-36533625 AAGCCCCCTCCCCTCCCCAGAGG - Intergenic
1039536912 8:38324771-38324793 AGCCCCACTCCCCTTCTCGGAGG - Intronic
1042304497 8:67316957-67316979 CAGCCCCCTCCCCTCCTTGGAGG - Intronic
1043223920 8:77699905-77699927 GAACCCCCTCCCCTCAGCTGAGG - Intergenic
1043414448 8:80033296-80033318 AACCCCCCTCCCCGCCCCGCCGG - Intronic
1043937144 8:86155156-86155178 AACCCCCCACCCCCCCGTGAAGG - Intergenic
1048246364 8:132806398-132806420 AACACCCTTCCCTTCCACGGTGG + Intronic
1048565161 8:135588496-135588518 CAGCCCCCTCCCCTCCTTGGAGG + Intronic
1050151455 9:2622395-2622417 TCCCTCCCTCCCCTCCGTGGTGG + Intronic
1050353663 9:4763327-4763349 CTCCTCCCTCCCCTCCGCGCAGG + Intergenic
1053399026 9:37801132-37801154 CACCTCCCTCCCCTCCGTGCCGG + Exonic
1056956425 9:91085170-91085192 AACCCCTCTCCCCTCCCTGGAGG - Intergenic
1060920093 9:127414436-127414458 CACCCCCCCCCCCACCGGGGTGG + Intergenic
1062344988 9:136110437-136110459 CACCTCCCGCCCCTCCGCAGGGG - Intergenic
1062385975 9:136311688-136311710 AACGTCCCTCCCCTCCCTGGAGG - Intergenic
1062738176 9:138150195-138150217 AAGCCCCGGCCCCTCCGGGGTGG - Intergenic
1203607144 Un_KI270748v1:68214-68236 ATCCGCCCACCCCACCGCGGCGG - Intergenic
1203657144 Un_KI270753v1:8873-8895 AACCCCTCTCCCCTCCCAGGAGG - Intergenic
1185610834 X:1392815-1392837 AACCCCCAGCCCCGGCGCGGAGG - Intergenic
1186513565 X:10149392-10149414 AGCCCCTCTCCCCTCCCCGGAGG + Intergenic
1189312378 X:40028766-40028788 AACCCCTCTCCCCTCCCCAGAGG - Intergenic
1189509947 X:41652592-41652614 AGCCCCTCTCCCCTCCCTGGAGG - Intronic
1189515561 X:41710770-41710792 AGCCCCTCTCCCCTCCTTGGAGG - Intronic
1191717825 X:64205346-64205368 AACCCCCCTCCCCCCAGCCGTGG + Intronic
1191871039 X:65745381-65745403 AGCCCCTCTCCCCTCCCTGGAGG - Intergenic
1192570825 X:72203048-72203070 AGCCCCTCTCCCCTCTGCAGAGG - Intronic
1195344134 X:103931849-103931871 CACCCCTCTCCCCTCCCTGGAGG - Intronic
1199230985 X:145436434-145436456 CACCTCCCTCCCCGACGCGGTGG - Intergenic
1199953203 X:152721947-152721969 CACCCCCCGCCCCCCCGCAGAGG + Intergenic
1199956479 X:152746499-152746521 CACCCCCCGCCCCCCCGCAGAGG - Intergenic
1200000169 X:153056203-153056225 CACCCCCATCCCCACTGCGGTGG - Intergenic