ID: 967904140

View in Genome Browser
Species Human (GRCh38)
Location 3:194486919-194486941
Sequence CGCCGCCGCGGAGGGGAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 538
Summary {0: 1, 1: 0, 2: 5, 3: 50, 4: 482}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967904140_967904159 16 Left 967904140 3:194486919-194486941 CCCCCCTCCCCTCCGCGGCGGCG 0: 1
1: 0
2: 5
3: 50
4: 482
Right 967904159 3:194486958-194486980 GGAGAGCCGGCAGGCAGGCGGGG 0: 1
1: 0
2: 2
3: 52
4: 475
967904140_967904156 11 Left 967904140 3:194486919-194486941 CCCCCCTCCCCTCCGCGGCGGCG 0: 1
1: 0
2: 5
3: 50
4: 482
Right 967904156 3:194486953-194486975 TGCGGGGAGAGCCGGCAGGCAGG 0: 1
1: 0
2: 0
3: 34
4: 395
967904140_967904155 7 Left 967904140 3:194486919-194486941 CCCCCCTCCCCTCCGCGGCGGCG 0: 1
1: 0
2: 5
3: 50
4: 482
Right 967904155 3:194486949-194486971 ACGCTGCGGGGAGAGCCGGCAGG 0: 1
1: 0
2: 0
3: 8
4: 136
967904140_967904149 -7 Left 967904140 3:194486919-194486941 CCCCCCTCCCCTCCGCGGCGGCG 0: 1
1: 0
2: 5
3: 50
4: 482
Right 967904149 3:194486935-194486957 GGCGGCGCCCGATCACGCTGCGG 0: 1
1: 0
2: 0
3: 4
4: 38
967904140_967904157 14 Left 967904140 3:194486919-194486941 CCCCCCTCCCCTCCGCGGCGGCG 0: 1
1: 0
2: 5
3: 50
4: 482
Right 967904157 3:194486956-194486978 GGGGAGAGCCGGCAGGCAGGCGG 0: 1
1: 1
2: 5
3: 78
4: 730
967904140_967904160 17 Left 967904140 3:194486919-194486941 CCCCCCTCCCCTCCGCGGCGGCG 0: 1
1: 0
2: 5
3: 50
4: 482
Right 967904160 3:194486959-194486981 GAGAGCCGGCAGGCAGGCGGGGG 0: 1
1: 0
2: 2
3: 41
4: 431
967904140_967904151 -5 Left 967904140 3:194486919-194486941 CCCCCCTCCCCTCCGCGGCGGCG 0: 1
1: 0
2: 5
3: 50
4: 482
Right 967904151 3:194486937-194486959 CGGCGCCCGATCACGCTGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 18
967904140_967904158 15 Left 967904140 3:194486919-194486941 CCCCCCTCCCCTCCGCGGCGGCG 0: 1
1: 0
2: 5
3: 50
4: 482
Right 967904158 3:194486957-194486979 GGGAGAGCCGGCAGGCAGGCGGG 0: 1
1: 1
2: 10
3: 147
4: 1284
967904140_967904162 28 Left 967904140 3:194486919-194486941 CCCCCCTCCCCTCCGCGGCGGCG 0: 1
1: 0
2: 5
3: 50
4: 482
Right 967904162 3:194486970-194486992 GGCAGGCGGGGGAGCGCGCGCGG 0: 1
1: 0
2: 8
3: 67
4: 631
967904140_967904154 3 Left 967904140 3:194486919-194486941 CCCCCCTCCCCTCCGCGGCGGCG 0: 1
1: 0
2: 5
3: 50
4: 482
Right 967904154 3:194486945-194486967 GATCACGCTGCGGGGAGAGCCGG 0: 1
1: 0
2: 0
3: 6
4: 121
967904140_967904150 -6 Left 967904140 3:194486919-194486941 CCCCCCTCCCCTCCGCGGCGGCG 0: 1
1: 0
2: 5
3: 50
4: 482
Right 967904150 3:194486936-194486958 GCGGCGCCCGATCACGCTGCGGG 0: 1
1: 0
2: 0
3: 5
4: 38
967904140_967904163 29 Left 967904140 3:194486919-194486941 CCCCCCTCCCCTCCGCGGCGGCG 0: 1
1: 0
2: 5
3: 50
4: 482
Right 967904163 3:194486971-194486993 GCAGGCGGGGGAGCGCGCGCGGG 0: 1
1: 0
2: 3
3: 54
4: 500

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967904140 Original CRISPR CGCCGCCGCGGAGGGGAGGG GGG (reversed) Intronic