ID: 967904143

View in Genome Browser
Species Human (GRCh38)
Location 3:194486922-194486944
Sequence GGGCGCCGCCGCGGAGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 467
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 429}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967904143_967904155 4 Left 967904143 3:194486922-194486944 CCCTCCCCTCCGCGGCGGCGCCC 0: 1
1: 0
2: 2
3: 35
4: 429
Right 967904155 3:194486949-194486971 ACGCTGCGGGGAGAGCCGGCAGG 0: 1
1: 0
2: 0
3: 8
4: 136
967904143_967904157 11 Left 967904143 3:194486922-194486944 CCCTCCCCTCCGCGGCGGCGCCC 0: 1
1: 0
2: 2
3: 35
4: 429
Right 967904157 3:194486956-194486978 GGGGAGAGCCGGCAGGCAGGCGG 0: 1
1: 1
2: 5
3: 78
4: 730
967904143_967904156 8 Left 967904143 3:194486922-194486944 CCCTCCCCTCCGCGGCGGCGCCC 0: 1
1: 0
2: 2
3: 35
4: 429
Right 967904156 3:194486953-194486975 TGCGGGGAGAGCCGGCAGGCAGG 0: 1
1: 0
2: 0
3: 34
4: 395
967904143_967904151 -8 Left 967904143 3:194486922-194486944 CCCTCCCCTCCGCGGCGGCGCCC 0: 1
1: 0
2: 2
3: 35
4: 429
Right 967904151 3:194486937-194486959 CGGCGCCCGATCACGCTGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 18
967904143_967904150 -9 Left 967904143 3:194486922-194486944 CCCTCCCCTCCGCGGCGGCGCCC 0: 1
1: 0
2: 2
3: 35
4: 429
Right 967904150 3:194486936-194486958 GCGGCGCCCGATCACGCTGCGGG 0: 1
1: 0
2: 0
3: 5
4: 38
967904143_967904158 12 Left 967904143 3:194486922-194486944 CCCTCCCCTCCGCGGCGGCGCCC 0: 1
1: 0
2: 2
3: 35
4: 429
Right 967904158 3:194486957-194486979 GGGAGAGCCGGCAGGCAGGCGGG 0: 1
1: 1
2: 10
3: 147
4: 1284
967904143_967904162 25 Left 967904143 3:194486922-194486944 CCCTCCCCTCCGCGGCGGCGCCC 0: 1
1: 0
2: 2
3: 35
4: 429
Right 967904162 3:194486970-194486992 GGCAGGCGGGGGAGCGCGCGCGG 0: 1
1: 0
2: 8
3: 67
4: 631
967904143_967904163 26 Left 967904143 3:194486922-194486944 CCCTCCCCTCCGCGGCGGCGCCC 0: 1
1: 0
2: 2
3: 35
4: 429
Right 967904163 3:194486971-194486993 GCAGGCGGGGGAGCGCGCGCGGG 0: 1
1: 0
2: 3
3: 54
4: 500
967904143_967904159 13 Left 967904143 3:194486922-194486944 CCCTCCCCTCCGCGGCGGCGCCC 0: 1
1: 0
2: 2
3: 35
4: 429
Right 967904159 3:194486958-194486980 GGAGAGCCGGCAGGCAGGCGGGG 0: 1
1: 0
2: 2
3: 52
4: 475
967904143_967904154 0 Left 967904143 3:194486922-194486944 CCCTCCCCTCCGCGGCGGCGCCC 0: 1
1: 0
2: 2
3: 35
4: 429
Right 967904154 3:194486945-194486967 GATCACGCTGCGGGGAGAGCCGG 0: 1
1: 0
2: 0
3: 6
4: 121
967904143_967904160 14 Left 967904143 3:194486922-194486944 CCCTCCCCTCCGCGGCGGCGCCC 0: 1
1: 0
2: 2
3: 35
4: 429
Right 967904160 3:194486959-194486981 GAGAGCCGGCAGGCAGGCGGGGG 0: 1
1: 0
2: 2
3: 41
4: 431
967904143_967904149 -10 Left 967904143 3:194486922-194486944 CCCTCCCCTCCGCGGCGGCGCCC 0: 1
1: 0
2: 2
3: 35
4: 429
Right 967904149 3:194486935-194486957 GGCGGCGCCCGATCACGCTGCGG 0: 1
1: 0
2: 0
3: 4
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967904143 Original CRISPR GGGCGCCGCCGCGGAGGGGA GGG (reversed) Intronic
900096768 1:942970-942992 AGGGGCCGGCGCCGAGGGGAAGG + Exonic
900101541 1:964208-964230 GGGCCCCGCGGCGCACGGGAGGG - Intronic
900366791 1:2314861-2314883 GGGCGCCGCCCCGGACGGCAGGG - Intergenic
900512673 1:3068013-3068035 AGGCGCTGCGGCGGAGGGGCCGG - Intergenic
902251010 1:15154119-15154141 GGGCGCGGCCGCAGAGGGTGCGG - Intronic
902823383 1:18956718-18956740 GGGCGGGGCCGCGGCGGGGGCGG - Intergenic
903750408 1:25617475-25617497 GGGCCCCGGCGCGGCGGGGAGGG + Exonic
903855633 1:26336443-26336465 GGGCGCGGCCGCGGGGTGGACGG - Intronic
904039388 1:27575472-27575494 GGGCGCCTCCGCGGCGAGGGTGG - Intronic
904699737 1:32351382-32351404 GGGCGCAGACCCGGAGGGAAGGG - Intergenic
904744467 1:32702626-32702648 GAGCCCCGGCGCGGCGGGGACGG - Exonic
904822678 1:33256018-33256040 GGGAGCCCCCGCGCTGGGGAAGG + Intergenic
906069664 1:43007676-43007698 GGGCGGGGACGGGGAGGGGAGGG - Intergenic
906680262 1:47721483-47721505 GGGCTCAGCTGCGGAGGTGAGGG - Intergenic
906695048 1:47818038-47818060 GTGTGCCGCCGCGGAGAGGCAGG + Intronic
907294284 1:53439606-53439628 GGGCGCCGGGGCGAAGGGGCGGG - Intergenic
908131839 1:61082370-61082392 CGCCGCCGCCGCGGGGGGGAGGG - Intronic
911527544 1:99004758-99004780 GGGCGCGGCGGCGGAGGCGGCGG + Exonic
912561651 1:110555602-110555624 GGCGGCCGCCGCGGTGTGGAGGG + Intergenic
912680287 1:111725078-111725100 GGGCGCAGCCGCGGTGGTTAGGG - Exonic
914918042 1:151830322-151830344 GGGAGCAGCCGTTGAGGGGAGGG + Intronic
915167787 1:153958247-153958269 GGGCGCCGCAGCGAAGGAGGCGG - Intronic
915238457 1:154502451-154502473 GGCGCCAGCCGCGGAGGGGAGGG - Intronic
916233346 1:162561658-162561680 GGGGGCCGCGGCGGCGGGGCGGG - Exonic
917446315 1:175108490-175108512 GGGCGCCGTGGAGCAGGGGATGG + Intronic
918064435 1:181089664-181089686 GGACGACGACGCGGAGGAGATGG + Exonic
920881981 1:209888984-209889006 GGGCGCCGCGGAGCAGGGGGCGG + Intergenic
922175965 1:223197913-223197935 TGGCGCAGCCGCGGTGGAGAAGG - Intergenic
922250719 1:223846271-223846293 CGGAGCCGCCGAGGAGGTGACGG - Intergenic
922440894 1:225653771-225653793 GGGCGCAGCCGCGGCGAGGGCGG - Intergenic
922496509 1:226062257-226062279 GGGCCGCGGCGGGGAGGGGAGGG - Intronic
922566618 1:226605593-226605615 GGGGGCGGCTGCTGAGGGGATGG - Exonic
922586683 1:226738689-226738711 GGGCAGCGCCGCGGAGCGCAGGG + Intronic
923126767 1:231040271-231040293 GGGCACCGCCGGGAAGGGGGCGG - Intergenic
923505269 1:234600139-234600161 GGGCGGCGGAGCGGAGGGGCGGG + Intergenic
924454853 1:244211112-244211134 GGAGGCCGCTGCGGAGGGGCTGG - Intergenic
924957660 1:248944878-248944900 CGGCGCCTCCCCGGAGGGGAGGG - Intergenic
1062874028 10:931314-931336 GGACGCGGCCGCGGCGGGCAGGG - Intronic
1064354283 10:14603989-14604011 GGGGGGCGCCGCGGAGGCGGGGG - Intronic
1064981991 10:21174254-21174276 GGGCGCAGCGGGGGAGGGGGCGG + Intergenic
1065342870 10:24723343-24723365 GGGCGGCGGGGCGGAGGGAAGGG - Intronic
1066049194 10:31619245-31619267 GGGAGCCACCTCGGAGGGGAGGG + Intergenic
1066370411 10:34814841-34814863 GGGCGCGGGCGGGGAGGGGGCGG - Intronic
1067084159 10:43229415-43229437 GGGCCGCGCCGCGAAGGGCAGGG + Intronic
1067116178 10:43437088-43437110 GGGCGGGGCCGCCGAGGGGCGGG - Intronic
1068228952 10:54144609-54144631 GGGTGCTGCCGCTGAGGCGATGG - Intronic
1068620503 10:59176676-59176698 GAGAGCCGCCGCGAAGGCGACGG - Exonic
1071695296 10:87863518-87863540 CGGCGCGGCGGCGGAGGGGGCGG + Exonic
1072152317 10:92692568-92692590 GGCCGCCTCCGGGGAAGGGAAGG + Intronic
1072673142 10:97446268-97446290 GGGCGCCGAGTCGGAGGGGGTGG + Exonic
1072700038 10:97633808-97633830 GGGCCCCGCCGCGGAGTTTAAGG + Intronic
1073099573 10:100999732-100999754 GGGCGGCACCGCGCAGGGGAGGG - Exonic
1073290127 10:102409301-102409323 GGGCGCCGACGGGAAAGGGAGGG + Intronic
1075147215 10:119892618-119892640 TGGCGTCGCCGTGTAGGGGAAGG + Intergenic
1075566780 10:123510848-123510870 TGGCTCGGGCGCGGAGGGGATGG - Intergenic
1076116949 10:127907395-127907417 GGCCGCTGCCGCGGGAGGGAGGG + Intronic
1076963504 10:133786396-133786418 CGGCGCCTCCCCGGAGGGGAGGG - Intergenic
1077172635 11:1174767-1174789 GGACCCGGCCGAGGAGGGGAGGG + Intronic
1078210380 11:9265283-9265305 CGGCGGCGGCGCGGAGGGGAAGG - Exonic
1079090403 11:17476593-17476615 GCGAGCCGCGGAGGAGGGGACGG - Intronic
1080456898 11:32427004-32427026 GGGTCCCCGCGCGGAGGGGAGGG + Intronic
1080475215 11:32583946-32583968 GGGTGCCGCCACGGTGGGGTGGG + Intronic
1081808201 11:45901245-45901267 GGGAGCCTCCGTGGAGTGGAGGG + Intronic
1081899667 11:46617235-46617257 GGGCGCTGACGCGGAAGGGGCGG - Intronic
1083648450 11:64186395-64186417 GGGCGGCGGCGGGGAGGTGAGGG + Intronic
1083743508 11:64723084-64723106 GGGCGGGGACGCGGCGGGGAGGG - Exonic
1083753734 11:64778186-64778208 AGGCAGCGCCGCGAAGGGGAAGG + Exonic
1084028442 11:66467032-66467054 GGCCGCCGGGGCGGAGGGGGCGG + Intronic
1084192546 11:67505429-67505451 GGACCCCGCCGGGGTGGGGAGGG - Intronic
1084332869 11:68439922-68439944 GGGCGGGGCCGGGGAGGGGCGGG + Intronic
1085043922 11:73342792-73342814 GGACGCTGCCGCGTGGGGGAAGG + Intronic
1085095865 11:73760478-73760500 GGGAGCCTCCGCGGACGGAAGGG + Intronic
1085561267 11:77474205-77474227 CGCCGCCGCCGCGCCGGGGAGGG - Intronic
1085666218 11:78417615-78417637 GGGCGCGGCCGCCCAGGGGCGGG - Intronic
1086981065 11:93198015-93198037 GGGCACCGCCGGCGAGGGGCGGG + Intergenic
1087241815 11:95789506-95789528 GGGCCCCGCCTCGGAGCGGGCGG - Exonic
1089297820 11:117480575-117480597 GGGTGCGGCAGTGGAGGGGAGGG + Intronic
1090978389 11:131695031-131695053 GAGCGCCGCCGCCGCCGGGAGGG + Intronic
1091571544 12:1691150-1691172 GGGAGCCACCGCTGAGGGGAGGG - Exonic
1091616202 12:2052926-2052948 GGGCGCGGGCGCGGCGGGGCTGG + Intronic
1091740804 12:2959357-2959379 GCGCGCCGCGGCGGGAGGGAGGG - Intronic
1092253572 12:6914694-6914716 GGGCGCCGCGGCGAAGGGAGGGG - Intronic
1092627451 12:10342246-10342268 GGGTGCCGCAGCTGAGGAGATGG - Intergenic
1092654876 12:10673926-10673948 GGGGGCGGGCGCGGCGGGGAGGG - Intronic
1094703843 12:32896476-32896498 GGGCGGCGCCGGGGAGCGGCGGG + Intronic
1095310499 12:40692466-40692488 GGGCTCCGCCGAGGCGAGGAGGG + Intronic
1095432021 12:42144665-42144687 GGGCGCGGCGGCGGCGGCGAAGG - Exonic
1095923346 12:47553379-47553401 GGGTGCTGCAGCTGAGGGGATGG - Intergenic
1096100916 12:48970046-48970068 CGGCGCTGCCGCGGAGGCTAGGG - Intronic
1096749247 12:53748280-53748302 GGGCGCTGGCGCGGAGGGCTTGG - Intergenic
1097029393 12:56080436-56080458 GCGCGCAGCCTCGGAGGGTATGG + Intronic
1098036038 12:66302778-66302800 GGGTGCCTCCGCGGTGAGGAAGG + Exonic
1098160967 12:67648441-67648463 GGGCGCCGCGGGGCCGGGGAGGG + Intronic
1100618408 12:96249377-96249399 GCGCGCCACTGCGGAGGGGGAGG + Intronic
1101037262 12:100717574-100717596 GGGCGGCGGGGCGGAAGGGAGGG + Intronic
1102678082 12:114672075-114672097 GGCCGCCGCCATGGAGGGCAGGG + Exonic
1103534763 12:121626830-121626852 AGCCGCCGCCGCAGCGGGGACGG + Exonic
1104093281 12:125533667-125533689 AGCCTCCGCCGGGGAGGGGAGGG - Intronic
1104609664 12:130217755-130217777 GGGAGCCGCTGGGCAGGGGAGGG + Intergenic
1104903915 12:132203552-132203574 GCGCGCCGCCGAGGTGTGGATGG - Exonic
1106517001 13:30464913-30464935 GGGGAGCGGCGCGGAGGGGAGGG - Intronic
1106720034 13:32427658-32427680 GGGCGCGGGCACGGAGAGGAGGG - Intronic
1107259331 13:38472463-38472485 GGGCGCCGTGGAGCAGGGGATGG + Intergenic
1107605217 13:42049168-42049190 GGGCGCGGGCGGGGCGGGGAGGG + Intronic
1113769976 13:112901573-112901595 GGTCACCGCCTGGGAGGGGAAGG + Intronic
1113779753 13:112969272-112969294 GGGCGCGGCGGAGGCGGGGAGGG - Exonic
1113887916 13:113670710-113670732 GGGTGCCCAGGCGGAGGGGAGGG + Intronic
1113887932 13:113670755-113670777 GGGTGCCCAGGCGGAGGGGAGGG + Intronic
1113887949 13:113670801-113670823 GGGTGCCCAGGCGGAGGGGAGGG + Intronic
1113989938 13:114353236-114353258 CGGCGCCTCCCCGGAGGGGAGGG - Intergenic
1114318320 14:21526270-21526292 GGGAGCAGCGGCGGAGGGGGAGG + Intronic
1115028485 14:28767720-28767742 GGGCGCCGGCGCCGGGGGGGAGG + Exonic
1116430090 14:44836135-44836157 GGGCCCCGCCGGGGTGGGGGAGG - Intergenic
1117837209 14:59819632-59819654 GGGCGCTGCGGAGCAGGGGACGG + Intronic
1118388901 14:65280193-65280215 TGCCGCCACCGCCGAGGGGATGG - Intergenic
1118849561 14:69573470-69573492 GGGCACCGCCGCGGAGGCCGAGG + Exonic
1118854620 14:69611549-69611571 GGGAGGCCCCGCGGAGGGGAGGG - Intergenic
1121050441 14:90816334-90816356 GGGCGCCGCGGCGGCGGCGGTGG - Exonic
1122275165 14:100587339-100587361 GCGCTCGGCCTCGGAGGGGAGGG - Intronic
1122470848 14:101964948-101964970 GTGCGGGGCCGCGGAGGGCAGGG + Intronic
1122558011 14:102592006-102592028 GGGGGCCGCGGCGCGGGGGACGG - Intergenic
1122843514 14:104478000-104478022 GGCCGCCGCCTCTGAGTGGAGGG - Intronic
1122931314 14:104933993-104934015 GGGACCCGCGGCTGAGGGGACGG + Exonic
1122931330 14:104934028-104934050 GGGACCCGCGGCTGAGGGGACGG + Exonic
1122961109 14:105093929-105093951 GGGCGGAGCCGCGGAGGTGTGGG + Intergenic
1124453872 15:29822554-29822576 GGGCGGGGCCGCGGCGGGGGAGG + Intronic
1125732473 15:41900944-41900966 GGGCGCCGACGAGGAGGAGTGGG - Exonic
1128078309 15:64841817-64841839 GGGCGGGGCCGGGGAGGGGGCGG - Intergenic
1128598522 15:68975702-68975724 GGGCGCCGTGGAGTAGGGGACGG + Intronic
1128742988 15:70096325-70096347 GGGCGCCGTTGGGGAGGGGCCGG - Intronic
1129082564 15:73052982-73053004 GGGCGCCACCGGGGAAGGGGCGG + Intronic
1129379127 15:75154481-75154503 GGGTTCTGCCGGGGAGGGGAGGG - Intergenic
1131094810 15:89648492-89648514 GGCGGCCGCCGCGGAGGCGGTGG + Exonic
1131108429 15:89749985-89750007 AAGGGCCGCCGCGGTGGGGACGG + Exonic
1132519078 16:379155-379177 GGGAGCTGCAGCAGAGGGGAGGG - Intronic
1132519875 16:382050-382072 GGGCGCGGACGCCGGGGGGAGGG + Intronic
1132663771 16:1072735-1072757 GGGCGCCGGCTGGGAGGGGGCGG - Intergenic
1132897685 16:2236721-2236743 AGGGGCGGCCGCGGAGGGAAGGG + Exonic
1133201536 16:4207109-4207131 GGGCGCCTCCGAGGAGGCCACGG - Intronic
1133213104 16:4273779-4273801 GGGCCCCGGCAGGGAGGGGAGGG + Intergenic
1134132148 16:11657242-11657264 GTGAGCCACCGCGGTGGGGAAGG + Intergenic
1134290611 16:12901108-12901130 GGGCGCAGCCGGGAAGGGCAAGG + Intergenic
1136220189 16:28823461-28823483 GGGCTCCGCCGGGGAGCCGAAGG + Exonic
1136867900 16:33770995-33771017 GGGCGCCGGCGCGTAGGCAAGGG - Intergenic
1137757209 16:50912279-50912301 GGGCGCGGGAGTGGAGGGGAGGG - Intergenic
1138379425 16:56589950-56589972 GGGGGCGGCGGCAGAGGGGAAGG - Intronic
1139364973 16:66427449-66427471 GGGCGGCGCGGGGGAGGGGCGGG + Intronic
1140078425 16:71723269-71723291 GGCCGGCGCCGCGGAGGGTTCGG - Intronic
1140504646 16:75463986-75464008 GAGCGCCTGCGCGGAGGGGCCGG + Intronic
1141369319 16:83472510-83472532 GGGCACCGCCGCTCAGGGGCGGG + Intronic
1141615295 16:85206670-85206692 GGGCCCAGCCGGGGAGGGGACGG - Intergenic
1142130685 16:88430350-88430372 GGGCGGCGCAGCAGAGGGGTCGG + Exonic
1142240232 16:88941512-88941534 GGGCGCCGCCCCGGTGGCGGAGG - Intronic
1203104279 16_KI270728v1_random:1345297-1345319 GGGCGCCGGCGCGTAGGCAAGGG + Intergenic
1203129235 16_KI270728v1_random:1617071-1617093 GGGCGCCGGCGCGTAGGCAAGGG - Intergenic
1142603753 17:1070524-1070546 GTTCGCCGCCGCGGTCGGGAGGG - Intronic
1142604734 17:1075188-1075210 GGGCGCAGCCGCGTACAGGAAGG - Intronic
1142978571 17:3658973-3658995 GGGGGCTTCCGAGGAGGGGAAGG + Intronic
1143202532 17:5122597-5122619 GGGCCCCGCAGCGGAGGGTCGGG - Intronic
1143478802 17:7217356-7217378 GGGCTCCCCAGTGGAGGGGAGGG + Intronic
1143565427 17:7717658-7717680 GGGCGCCTGCGCGGAGGAGGCGG + Exonic
1143590665 17:7884683-7884705 GGACGCCGCCGCCGAGGAGGAGG + Intronic
1145063145 17:19744799-19744821 GCGGGGCGCGGCGGAGGGGAGGG + Intronic
1146398463 17:32486629-32486651 GGGCGGCGGCGCGGAGCGGGCGG + Exonic
1146398832 17:32488015-32488037 GGGCGTCCCTGCGGAGGTGACGG - Exonic
1146846146 17:36183189-36183211 GGGCCCCGCAGCGGAGGGTCGGG + Intronic
1147139532 17:38453626-38453648 AGGGGCCGCCCCGGAGGGGGAGG + Intronic
1147907592 17:43833044-43833066 GGGCGCCGCGGCGGGAGGGGCGG - Intronic
1148388629 17:47254192-47254214 GCGCGCCGCGGCGGCCGGGAAGG - Intronic
1148852546 17:50561831-50561853 GGGGGCTGCCAGGGAGGGGAGGG + Intronic
1149849495 17:60026614-60026636 GGGCCCCGCAGCGGAGGGTCGGG + Intergenic
1149860673 17:60119910-60119932 GGGCCCCGCAGCGGAGGGTCGGG - Intergenic
1150562207 17:66303297-66303319 GGGCGCGCCCGGGGAGGTGAGGG - Intronic
1150675702 17:67244900-67244922 GCGGGCCCCAGCGGAGGGGAAGG + Intronic
1151780102 17:76240118-76240140 GGGCGCCGCAGCCGCGAGGAGGG - Intronic
1152070424 17:78131441-78131463 CGACGCCGGCGCAGAGGGGACGG + Exonic
1152345326 17:79747670-79747692 CCGCGCCGCTGCGGTGGGGAGGG - Intergenic
1152352887 17:79793188-79793210 GGGGACGGCCGCGGCGGGGAAGG - Exonic
1152512452 17:80799710-80799732 GGCGGCCGCCAGGGAGGGGAGGG - Intronic
1152527374 17:80896326-80896348 CGGCGCGGCCGTGGATGGGATGG - Intronic
1152606688 17:81295026-81295048 GGACGCCGGTGGGGAGGGGATGG + Exonic
1152744271 17:82031858-82031880 GGGCGCAGCCGGGGCGGGGCGGG + Intronic
1153959951 18:10132099-10132121 GGGGGCCGCGGCGGAGCGGGCGG - Intergenic
1154125546 18:11689456-11689478 CGGCGCCTCAGCGGAGGGGCGGG - Exonic
1155507689 18:26548696-26548718 GGGCAGCGGCGCGCAGGGGATGG + Intronic
1157354047 18:46917280-46917302 GGAGGCCGCGGGGGAGGGGATGG - Intronic
1160184059 18:76660904-76660926 GGGCCCCGCCCTGGAGGGGCTGG + Intergenic
1160204514 18:76822317-76822339 GGGCGCGGGCGCGGTGGGGGCGG - Intergenic
1160682397 19:417834-417856 GGCCGCGGCCGCATAGGGGAGGG + Intronic
1160731627 19:643928-643950 GGGGGCAGGAGCGGAGGGGAGGG + Intergenic
1160747896 19:720286-720308 GGGCGCCGCCGCCCCGGTGATGG - Intronic
1160765669 19:806450-806472 TGCCGCCGCCGCCGAGGGGATGG - Exonic
1160863638 19:1248213-1248235 GGGCGCCCGCGTGGGGGGGACGG - Intergenic
1161027203 19:2042209-2042231 GGGCGGGGCCGCGGCGGGGGAGG - Intronic
1161207201 19:3047269-3047291 CGGGGCGGCCGCGGCGGGGAGGG + Intronic
1161374556 19:3932946-3932968 GGGGGCCGGCGGGGCGGGGAGGG - Intergenic
1161471142 19:4457359-4457381 GGGCGCGGCGGGGGAGGCGAGGG - Intronic
1161510941 19:4670520-4670542 GGGCGGGGCCGCCGAGGGGGCGG + Intergenic
1161510950 19:4670537-4670559 GGGCGGGGCCGCCGAGGGGGCGG + Intergenic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1161967504 19:7556596-7556618 GGGCTCCTCCGGGGAGGGGTAGG - Intronic
1162432147 19:10635518-10635540 GGGCGTCCCCGGGGTGGGGAGGG + Intronic
1163026778 19:14517585-14517607 CGGGGCCGCCTCGGAGGGTAAGG - Intronic
1163144955 19:15373804-15373826 GGGAGCGGCGGCGGTGGGGAGGG - Exonic
1164639076 19:29811819-29811841 GGCCGGCGCCGTGGAGGGGCGGG + Intergenic
1165333715 19:35155121-35155143 GGGAGTCGGCGAGGAGGGGAAGG - Exonic
1165846636 19:38821824-38821846 AGGCGCCGCCGAGCAGGGGGTGG - Intronic
1165994283 19:39833391-39833413 GGCCGGCCCCGCGGCGGGGAGGG + Exonic
1166361328 19:42254041-42254063 GGGGGCGGCGGGGGAGGGGAGGG + Intronic
1166547057 19:43639910-43639932 GGGCGGGGCCGGGGAGGGGAGGG + Intergenic
1166807717 19:45497019-45497041 GGGCGGGGCCGAGGTGGGGAAGG + Exonic
1166953993 19:46449556-46449578 GGGCGCTGCCGCTGAGGAGATGG + Intergenic
1166984142 19:46649575-46649597 AGGCGCCGCCGCCGGGGGGCGGG - Exonic
1167037808 19:47004296-47004318 GGGCGCGGCCGCGGTGCGGTCGG + Exonic
1167310924 19:48737565-48737587 GGGCGGAGCCGCTGAGGGGCCGG - Intronic
1168315257 19:55482208-55482230 GGGGGCTGCGGCAGAGGGGACGG - Exonic
1168404192 19:56102425-56102447 GGCGGCCTCCGTGGAGGGGAGGG + Intronic
1168728639 19:58606850-58606872 CGGCGCCTCCCCGGAGGGGAGGG - Intergenic
925959676 2:9003474-9003496 GGGTGGCACCGCGGCGGGGAGGG + Intronic
926089872 2:10043189-10043211 GGGCGGCGGGGCGGAGGGGGCGG - Intronic
926157825 2:10467422-10467444 GGGTGCCCCGGGGGAGGGGAGGG + Intergenic
926321322 2:11750081-11750103 GAGCGAGGCCGGGGAGGGGAGGG - Intronic
927168800 2:20351071-20351093 GGGCTCCGCCGCGGCGGGCTCGG + Intronic
927713873 2:25341055-25341077 GGGCGCCGGCGGGGCCGGGAGGG - Intronic
929789798 2:45014080-45014102 GGGCGCGGGCGCGGCGGGCAGGG + Intergenic
931253849 2:60554145-60554167 GAGCGCGGCGGCGGCGGGGAGGG - Intergenic
932496409 2:72147866-72147888 GGCCGCGGCGGGGGAGGGGAGGG + Exonic
932567688 2:72919982-72920004 GGCCGCCGCGGCCGAGGGGCTGG + Intronic
932611407 2:73202839-73202861 GGCCGCCGGCGCGCAGGGGTCGG - Exonic
934296833 2:91749086-91749108 GGGCGCCGCCGCGGCGCTGGTGG - Intergenic
934564102 2:95328953-95328975 GGGAGCTGCAGAGGAGGGGAGGG + Intronic
934763842 2:96869739-96869761 GGGAGCCGCGGCGGCGGAGACGG - Intronic
936151524 2:110024634-110024656 GCCAGCCGCCGCGGTGGGGAAGG + Intergenic
936193150 2:110346735-110346757 GCCAGCCGCCGCGGTGGGGAAGG - Intergenic
936569863 2:113603854-113603876 CGGCGCCTCCCCGGAGGGGAGGG + Intergenic
937863530 2:126731542-126731564 GGGGGCTGCCTCGGTGGGGAGGG + Intergenic
938639889 2:133266950-133266972 GGGGGGCCCGGCGGAGGGGAGGG - Intronic
939612958 2:144332353-144332375 GGCGGGCGCCGGGGAGGGGAGGG + Intronic
942451089 2:176108170-176108192 GGGGGCCGCGGGGGAGGGGGGGG + Intronic
946185533 2:217978670-217978692 GGGCGCCGGCGGGGCGGGGGCGG - Intronic
947602674 2:231464259-231464281 GCGCGGCGCCGCGGGGAGGAGGG - Intronic
948988714 2:241541256-241541278 GGGCGGGGCCGCGGCGGGGGCGG + Intergenic
949088898 2:242182487-242182509 CGGCGCCTCCCCGGAGGGGAGGG - Intergenic
1168760635 20:347565-347587 GGGCGCCCTCCCGGGGGGGATGG - Intronic
1170562538 20:17569776-17569798 TGGCCCCGCCGAGGAGGCGAAGG + Intergenic
1170756807 20:19212491-19212513 GGGCGGCGGCGCGGCGGGGGCGG - Intergenic
1171033910 20:21701628-21701650 GAGCGCCGCCTCGGAGCGCAAGG - Intergenic
1171223200 20:23420479-23420501 GGGCCCCGCCGGGGAGGGGGCGG - Intronic
1174246888 20:49188250-49188272 GGGCGCCGCCGGGCCGGGGGGGG + Exonic
1174804482 20:53593844-53593866 AGGAGCGGGCGCGGAGGGGAGGG + Intronic
1175910150 20:62401399-62401421 GGGCGCTGCTGCTGACGGGACGG + Intronic
1176016802 20:62938116-62938138 GGGGGCCGCGGCGGAGGCGGGGG - Exonic
1176548464 21:8211884-8211906 GGGAGCCGGCGCGGCGGGGCCGG - Intergenic
1176548481 21:8211930-8211952 GAGCGGCGCGGCGGAGGCGACGG - Intergenic
1176555772 21:8253453-8253475 GGGCGGCGGCGAGGCGGGGACGG - Intergenic
1176556358 21:8256092-8256114 GGGAGCCGGCGCGGCGGGGCCGG - Intergenic
1176556375 21:8256138-8256160 GAGCGGCGCGGCGGAGGCGACGG - Intergenic
1176567395 21:8394919-8394941 GGGAGCCGGCGCGGCGGGGCCGG - Intergenic
1176567412 21:8394965-8394987 GAGCGGCGCGGCGGAGGCGACGG - Intergenic
1176574709 21:8436487-8436509 GGGCGGCGGCGAGGCGGGGACGG - Intergenic
1176575297 21:8439134-8439156 GGGAGCCGGCGCGGCGGGGCCGG - Intergenic
1176575314 21:8439180-8439202 GAGCGGCGCGGCGGAGGCGACGG - Intergenic
1176611323 21:8987780-8987802 GGGCGGCGGCGAGGCGGGGACGG - Intergenic
1176952558 21:15064613-15064635 GGGCGTCGGGGCGGCGGGGAGGG - Intronic
1178840568 21:36135010-36135032 CGGCCCCTCCTCGGAGGGGAGGG + Exonic
1178992253 21:37366317-37366339 GGGCGCCGACGCGGAAGCGCGGG + Intronic
1179481751 21:41682788-41682810 GGGCGCCGGGGCGGAGAGGCAGG + Intergenic
1179953933 21:44727493-44727515 GGAGGCTGCGGCGGAGGGGAGGG - Intergenic
1179976892 21:44873463-44873485 GGGCGGGGCCGCGAAGGGGGCGG - Intronic
1180264122 21:46698769-46698791 CGGCGCCTCCCCGGAGGGGAGGG - Intergenic
1180560385 22:16610246-16610268 AGGAGCGGGCGCGGAGGGGAGGG + Intergenic
1181026665 22:20131255-20131277 GGGCCCCGCCTCGGGGAGGATGG + Intronic
1181094324 22:20495534-20495556 GGGCGCGGGCGCGTAGGGGCCGG - Intronic
1182261018 22:29073156-29073178 GAGCGCCGCGGCGGAGAGCAGGG - Exonic
1182824576 22:33253760-33253782 GGGCTGCACCTCGGAGGGGAAGG + Intronic
1183476490 22:38038781-38038803 GGGCGCCGGCGGGGGGAGGAGGG - Intronic
1183535507 22:38398526-38398548 AGGAGCGGGCGCGGAGGGGAGGG + Intergenic
1183665143 22:39242561-39242583 GGGGGCGGCCGCGGAAGGGCGGG + Intronic
1183856148 22:40636429-40636451 GGGCGAGGCCGCGGTGGGGGAGG + Intronic
1184472258 22:44702543-44702565 GGCCGCCGCCGCGGACGAGCGGG + Exonic
1184557394 22:45240749-45240771 GGGGGCGGCGGCGGCGGGGAGGG + Intronic
1184557461 22:45240970-45240992 GGGCGGGGCCGGGGCGGGGAAGG - Intergenic
1185055401 22:48576251-48576273 GGGGGGCGCCGCGGAGGGGGCGG - Intronic
1185229070 22:49670234-49670256 GGGCGCCGCGGAGCAGGGGGCGG + Intergenic
1185343036 22:50300015-50300037 GGGCGGCGCCGAGGAGGCGCGGG - Intronic
1185430360 22:50807150-50807172 CGGCACCTCCCCGGAGGGGAGGG - Intergenic
1203252757 22_KI270733v1_random:125538-125560 GGGCGGCGGCGAGGCGGGGACGG - Intergenic
1203253348 22_KI270733v1_random:128189-128211 GGGAGCCGGCGCGGCGGGGCCGG - Intergenic
1203253365 22_KI270733v1_random:128235-128257 GAGCGGCGCGGCGGAGGCGACGG - Intergenic
1203260813 22_KI270733v1_random:170624-170646 GGGCGGCGGCGAGGCGGGGACGG - Intergenic
1203261402 22_KI270733v1_random:173267-173289 GGGAGCCGGCGCGGCGGGGCCGG - Intergenic
1203261419 22_KI270733v1_random:173313-173335 GAGCGGCGCGGCGGAGGCGACGG - Intergenic
949860647 3:8501742-8501764 GAGCGCCGGCGCGGAGTGGCTGG + Exonic
950683993 3:14603232-14603254 GGGGGCGGGCGCGGAGAGGACGG + Intergenic
950729856 3:14947830-14947852 GGCCCCCGGCGCGGAGGGCAGGG - Intronic
950729927 3:14948072-14948094 GGCCGCGGGCGGGGAGGGGAGGG - Intronic
953031229 3:39181068-39181090 GCGTGCCGCCGAGGAGGGGCGGG - Intergenic
953947760 3:47163969-47163991 GGGCGACGCGGGGGAGGGGAGGG + Intergenic
954247011 3:49340021-49340043 GGCCGGGGCCGCGGAGGAGATGG - Exonic
954389256 3:50260308-50260330 CGGCGCCGCGGAGGCGGGGAGGG + Intergenic
954468937 3:50675205-50675227 GGGCGACAACGCGGCGGGGACGG - Intergenic
954553292 3:51499735-51499757 GGCCGCCGGCGAGGAGGGGGCGG - Intronic
956678006 3:71753619-71753641 GCGCGCTCCGGCGGAGGGGAGGG + Intronic
960669253 3:120140576-120140598 GGGCGCCGCAGAGCAGGGGGCGG - Intergenic
960684759 3:120285280-120285302 GGGCGGCGCCAGGGAGGGGCGGG - Intergenic
961929374 3:130517100-130517122 CGGGGCCGCCGGGGCGGGGAAGG + Intergenic
962322840 3:134405982-134406004 GGGGGGCGGCGGGGAGGGGAGGG + Intergenic
962520762 3:136195888-136195910 GGGCGCCGCCGCGGCCCGGCCGG - Intronic
963116936 3:141738320-141738342 TGGCGGCGCCGCGGAGCCGACGG - Exonic
966182983 3:177203907-177203929 GGGCGCCGCAGAGCAGGGGGCGG + Intergenic
966712037 3:182980734-182980756 GGGCGCGGCGGGGGAGGGGCGGG + Intronic
966864304 3:184248718-184248740 GTGCGCCGAGGGGGAGGGGAGGG - Intronic
966868637 3:184276250-184276272 GGGGTCGGCCGCGGAGGGGCAGG + Intronic
967904143 3:194486922-194486944 GGGCGCCGCCGCGGAGGGGAGGG - Intronic
968446111 4:653173-653195 GGACACCGCAGCGGAGGAGAGGG + Intronic
968498542 4:932365-932387 TGAGGCCGCGGCGGAGGGGACGG - Exonic
968603329 4:1520608-1520630 GGTCGCCGCCGCGTAGGGAGGGG - Intergenic
968809320 4:2792966-2792988 GGGACCCGCCGGGGAGGGGCGGG + Intergenic
968879855 4:3293225-3293247 GGGCGGCGACCCCGAGGGGACGG - Intronic
969113369 4:4857072-4857094 GGACTCCGCCGCGGGGGGGGGGG - Intergenic
969360286 4:6658889-6658911 GTGCGCCGAGGCGGAGAGGAAGG + Intergenic
970182641 4:13415711-13415733 GGGCGCCGTAGAGCAGGGGATGG - Intronic
970332942 4:15003490-15003512 CGGCGCCGCCACGGAGGCGCGGG + Exonic
971230839 4:24799478-24799500 GGACGCCCCCGCGGAGGTGGGGG - Intronic
971432607 4:26584137-26584159 GGCCGCCGGCGCGGAGCGAACGG - Exonic
971451367 4:26804667-26804689 GGGAGCAGCCGCGGAGGCGGCGG + Intergenic
971639872 4:29117682-29117704 GGGCGCCGTGGAGCAGGGGACGG - Intergenic
973551293 4:52038301-52038323 GGGTGCGGTCGCGGAGGGGCGGG - Exonic
973764252 4:54149341-54149363 GGGCGCCGCGGAGCAGGGGGTGG + Intronic
975118467 4:70704830-70704852 CGGCGGCGCAGCGGACGGGACGG + Intronic
976431216 4:84965940-84965962 GGGCGCCGTCGCGGACGGGTCGG - Intronic
977416705 4:96742847-96742869 GGGCGCCACGGAGCAGGGGACGG - Intergenic
977932187 4:102761040-102761062 GGGCGCAGCCGCGGGCGGGAGGG + Intergenic
980130527 4:128812167-128812189 GGACGCCGCTGCGGAGGGAGCGG + Intronic
981146673 4:141333050-141333072 GGGCGCCGTGGAGCAGGGGATGG + Intergenic
983752894 4:171298609-171298631 GGGCGCCGCCGTGGAGCAGGGGG - Intergenic
983834189 4:172369505-172369527 GGGCGCCGCGGAGCAGGGGGTGG + Intronic
984639283 4:182144592-182144614 GGGCGCCGGCGGGGCGGGGGCGG - Intronic
985466727 4:190203694-190203716 CGGCGCCTCCCCGGAGGGGAGGG - Intergenic
985541308 5:488882-488904 GGGCGCGGCCAGGGAGGGGCAGG + Intronic
985590931 5:764687-764709 GGGTGCCGCAGAGCAGGGGACGG - Intronic
985688646 5:1295068-1295090 GGGCGGGGCCGCGGAAAGGAAGG + Intronic
985727431 5:1523624-1523646 AGGCGCGGCCGAGGAGGGGCCGG - Intronic
985884718 5:2668671-2668693 GGGCGCCGGGGAGGAGGGGAAGG + Intergenic
985895479 5:2748306-2748328 CGGCGGCGCCCGGGAGGGGAGGG - Intronic
985933409 5:3077212-3077234 GGGAGCCGCAGTGGAGTGGAGGG - Intergenic
986449490 5:7850759-7850781 GCGGGCGGCCGCGGAGGGGCGGG - Intronic
986695784 5:10353650-10353672 GGGCGCCGAGGCGGAAGGGGCGG - Intergenic
992048917 5:72925819-72925841 GGGCGCCGCGGAGCAGGGGGCGG - Intergenic
992444034 5:76818924-76818946 GGGCGCAGCTGCGCAGGGAAGGG + Intronic
992487516 5:77210632-77210654 GGGCGCCGCGGCGGGGAGGGTGG + Intronic
994367088 5:98928674-98928696 GGGGACAGACGCGGAGGGGAAGG + Exonic
995342260 5:111073039-111073061 GGACGCCGCCGCCGGGGGAAAGG + Intronic
998117588 5:139549672-139549694 GGGCGCCGCGGAGCAGGGGGTGG - Intronic
998406204 5:141876186-141876208 GGGCGCTGCCGGGGTGGGGGTGG - Intronic
999399334 5:151252752-151252774 GGGCGGGGCCGGGCAGGGGATGG - Intronic
1002021228 5:176365602-176365624 GGGCGGCGCCGCGGCGGTGCTGG + Exonic
1002524340 5:179806962-179806984 TGGGGCCGCCGCGGAGTCGACGG + Intronic
1002559555 5:180072030-180072052 GGACGCGGCGGGGGAGGGGAAGG + Exonic
1004044744 6:12012608-12012630 GGGCGGCGGGGCGGAGGGGGGGG + Intronic
1004241310 6:13924960-13924982 CGGCGGCGCCTGGGAGGGGAGGG - Exonic
1004492372 6:16129104-16129126 CGGCGCCACCGCGGAGGACAGGG + Exonic
1005751257 6:28885166-28885188 GGGCGCCGCGGAGCAGGGGGCGG + Intergenic
1005940528 6:30556468-30556490 GGGCGCCCCGGCGGCGAGGAAGG + Exonic
1006259226 6:32854128-32854150 TGGCGGCGCCGCGAAGGGGCGGG + Intronic
1006427615 6:33976140-33976162 GGGCGCAGGCGGGGCGGGGAGGG - Intergenic
1006448560 6:34092937-34092959 GGGTGGCGCCCTGGAGGGGAGGG - Intronic
1007521308 6:42453077-42453099 GGGCCGGGCGGCGGAGGGGAGGG + Intergenic
1007902044 6:45422026-45422048 GGCGGCCGCCGCGGAGGCGGCGG + Intronic
1008760403 6:54846723-54846745 GGGCGCGGGCAGGGAGGGGAGGG - Intergenic
1008760482 6:54846937-54846959 GGCCGGCGCGGCGGACGGGAGGG + Intronic
1010044157 6:71420775-71420797 GCGAGCCGCTGCGGAGGGAAGGG - Intergenic
1011099825 6:83708845-83708867 GGGCGGCGCCGCTCAGGGGCGGG - Intronic
1013372621 6:109483433-109483455 GGGCGTGGCAGGGGAGGGGAGGG + Intergenic
1013459017 6:110358009-110358031 GGGCGCCGCCGGGGGGCGGCGGG - Exonic
1013803275 6:113970762-113970784 GGGCGCCGGGGCTGAGGGGTGGG - Intronic
1015935326 6:138402737-138402759 GGGCGCTGCCCAGGAAGGGAAGG - Intergenic
1017719679 6:157235988-157236010 GGGCGCTGCCCAGGAGCGGAGGG + Intergenic
1017914188 6:158819114-158819136 GGGACCCGGCGCCGAGGGGAAGG + Intronic
1017954945 6:159169679-159169701 GGCCGCCGCCGAGGAGGCGACGG - Exonic
1018876562 6:167826987-167827009 CGGCGCGGCCGCGGAGGCGGAGG + Exonic
1019453064 7:1109699-1109721 GGGCCCGGCGGGGGAGGGGAAGG - Intronic
1020784384 7:12556193-12556215 GGGCGCCGCGGAGCAGGGGGCGG + Intergenic
1021859640 7:24893737-24893759 GGGCGGCGGGGCGGGGGGGACGG + Intronic
1023722939 7:43113652-43113674 GGGAGCTGCCGGGGCGGGGAGGG + Intronic
1023918318 7:44606967-44606989 GGGCGCGGCGGCGGATGTGAGGG + Intronic
1024637285 7:51301171-51301193 GGGAGCCCCAGAGGAGGGGAGGG - Intronic
1025007658 7:55366549-55366571 GCGCTCCGCCGCGCAGGGGCGGG - Intronic
1026840417 7:73667726-73667748 CGGCGCGGCCGGGGCGGGGAGGG + Intergenic
1028762326 7:94509886-94509908 GGCCGCGGCCGAGGAGGGGCAGG + Exonic
1028796393 7:94908071-94908093 GGGCGCCTGCGAGGAGGGGGTGG + Intronic
1030033563 7:105389213-105389235 GGGAGAGGCCGCGGCGGGGAGGG - Intronic
1030820499 7:114086474-114086496 GGGCGCGCCCGGGGAGGGGGGGG - Intronic
1031134833 7:117873334-117873356 GGGGGCCGCGGCGGAGGCGGCGG - Exonic
1031629958 7:124033377-124033399 GGGCTAAGCAGCGGAGGGGATGG - Intergenic
1031986544 7:128167693-128167715 GGGCGCCGGCGAGGTGGCGAGGG + Intergenic
1032174351 7:129611689-129611711 CGCCGCCGCCGAGGAGGGGGAGG - Intergenic
1032240066 7:130153454-130153476 GGGGGCAGCCGCGGAGAGGCTGG + Intergenic
1032391248 7:131556651-131556673 GGGGGCCGGCGCTGACGGGACGG - Intronic
1034306380 7:150048059-150048081 GCGAGCCGCCGGGGAGGGGGCGG - Intergenic
1034441154 7:151086686-151086708 GGGCGGCGCGGCGGAGGCGGCGG - Intronic
1034800466 7:154052583-154052605 GCGAGCCGCCGGGGAGGGGGCGG + Intronic
1035264594 7:157684329-157684351 TGGAGCCGCCGCGGAGAGGGAGG + Intronic
1035325462 7:158062898-158062920 GGGCGCCGCGGAGCAGGGGGCGG - Intronic
1037835377 8:22212216-22212238 GGGAGCCGATGGGGAGGGGATGG + Exonic
1037901487 8:22691912-22691934 GGGCATCGCCGGGGAGGGAAAGG - Intronic
1038566264 8:28622538-28622560 GGGAGCCGACGCGGAGGCGGTGG + Intronic
1039903109 8:41767100-41767122 GGCTGCGGCCGCGGAGGGGCTGG - Intronic
1040039147 8:42897920-42897942 CGGCGCGGCCGGGGAGGGGGAGG + Intronic
1042278359 8:67028652-67028674 GGCCGCCGCCTCACAGGGGAAGG - Intronic
1044306466 8:90645935-90645957 GGGCGCCGCGGCGGAGGGGCTGG - Exonic
1044698914 8:94949193-94949215 GGCCGCCGGCTCGGCGGGGAAGG + Exonic
1044734840 8:95268874-95268896 ATGCGCTGCCGCGGAGGGTAGGG + Intronic
1045489208 8:102656137-102656159 GAGGCCCGGCGCGGAGGGGACGG - Intergenic
1045510138 8:102807130-102807152 GGGCGCCGCTCCGCAGTGGAAGG - Intergenic
1045583116 8:103500431-103500453 GCGCGCCGCCTCGGAGGGGAAGG - Intergenic
1046661152 8:116949781-116949803 GGGCGCCGCGGAGCAGGGGGCGG + Intergenic
1047277544 8:123417008-123417030 GAGCGCCCCCGAGGAGGGGCCGG - Intronic
1049500364 8:142959805-142959827 GGGCGCCGTGGAGCAGGGGACGG - Intergenic
1049552558 8:143267296-143267318 GGGCGCAGCCCACGAGGGGAGGG + Intronic
1049664282 8:143836087-143836109 GGGCGGCGCTGCCGTGGGGAAGG - Intronic
1049803854 8:144530221-144530243 GGGCACAGCAGCGGCGGGGAGGG - Exonic
1049891406 9:73546-73568 GAGCGGCGGCGCGGAGAGGAGGG - Intergenic
1049944464 9:580803-580825 GGGCGCCGCGGAGCAGGGGGCGG + Intronic
1050151458 9:2622400-2622422 AGGCGCCACCACGGAGGGGAGGG - Intronic
1050472542 9:6008034-6008056 GCGCGCCGCCGCCGGGGGGGAGG - Intergenic
1050906402 9:11011920-11011942 GGGAGCGGCCACGGTGGGGAGGG + Intergenic
1052824886 9:33167353-33167375 AGGCGCCGGCGGAGAGGGGAGGG + Exonic
1053003368 9:34589871-34589893 GCGCGCGGCCGCGGAGGCGCGGG - Intronic
1053399029 9:37801137-37801159 GGCCGCCGGCACGGAGGGGAGGG - Exonic
1054489434 9:65762638-65762660 GGGGGCCGCGGCGGTGGGGGGGG - Intergenic
1055301410 9:74887179-74887201 GGGCGGCGCCGCGTTGGGGAAGG + Intronic
1056383213 9:86074497-86074519 GGGCGCCAAGGTGGAGGGGAAGG - Intronic
1057259658 9:93576646-93576668 AGGCGGCGCCGCGGCCGGGAGGG - Exonic
1057361148 9:94374755-94374777 CGGCGACGCCGCGGAGGCGGCGG - Exonic
1057448350 9:95134832-95134854 AGGCGCCACCGCGCAGGGGAGGG + Intronic
1057489149 9:95508373-95508395 CGCCGCCGCCGCCGCGGGGACGG + Exonic
1057662213 9:97013409-97013431 CGGCGACGCCGCGGAGGCGGCGG + Exonic
1057797467 9:98169196-98169218 GGGCGGCGCGGGGGCGGGGAAGG - Intronic
1060514566 9:124257896-124257918 GCGCGGCCCCGCGGCGGGGAGGG + Intronic
1060736213 9:126067974-126067996 GGGAGCAGGGGCGGAGGGGAGGG + Intergenic
1061365786 9:130172095-130172117 GGCCCCCGCCGCGGCGGGGAGGG - Intergenic
1062084447 9:134641634-134641656 GGGCGCCGCGGGCGAGGGGGTGG - Intergenic
1062341510 9:136095585-136095607 GGACGCCGCGGCGCAGAGGACGG + Intergenic
1062385974 9:136311683-136311705 TGGCGCCTCCAGGGAGGGGAGGG + Intergenic
1062447488 9:136601808-136601830 GGGCCCCGGCGGAGAGGGGAAGG - Intergenic
1062620231 9:137417240-137417262 GGGCGCCGCAGGGACGGGGATGG + Intronic
1062646536 9:137551043-137551065 GGGTGCAGCTGGGGAGGGGATGG + Intergenic
1203469160 Un_GL000220v1:108689-108711 GGGCGGCGGCGAGGCGGGGACGG - Intergenic
1203469748 Un_GL000220v1:111336-111358 GGGAGCCGGCGCGGCGGGGCCGG - Intergenic
1203469765 Un_GL000220v1:111382-111404 GAGCGGCGCGGCGGAGGCGACGG - Intergenic
1203476981 Un_GL000220v1:152661-152683 GGGCGGCGGCGAGGCGGGGACGG - Intergenic
1203477569 Un_GL000220v1:155308-155330 GGGAGCCGGCGCGGCGGGGCCGG - Intergenic
1203477586 Un_GL000220v1:155354-155376 GAGCGGCGCGGCGGAGGCGACGG - Intergenic
1185468868 X:370861-370883 CGGGGCTGCCGCGTAGGGGACGG + Intronic
1186107928 X:6226766-6226788 GGGAGCAGCCGCGGAGTGGAGGG + Intronic
1186669996 X:11758364-11758386 AGGTGCCGCCGCGGAGGGACAGG + Exonic
1187826148 X:23334641-23334663 GGGCGCGGCCGCGGGCAGGAGGG + Exonic
1190203525 X:48383603-48383625 GTGCACCACGGCGGAGGGGAGGG - Intronic
1190207011 X:48411801-48411823 GTGCACCACGGCGGAGGGGAGGG + Intronic
1196707285 X:118727518-118727540 GGGGGCCGGCGCAGACGGGAAGG - Intergenic
1198694496 X:139321131-139321153 GGGCGCCGTCGAGCAGGGGGCGG - Intergenic
1200058774 X:153474828-153474850 GGGCGCAGCCGCGCAGGCGGCGG + Intronic
1200068809 X:153517898-153517920 GGGCGCCGCCGGGGTGGGCGCGG + Intronic
1200086116 X:153606765-153606787 GGGCGACGCAGTGGAGGGCAGGG + Intergenic
1201424612 Y:13834336-13834358 GGGAGCCGGCATGGAGGGGAAGG - Intergenic
1201489449 Y:14524786-14524808 GAGCGCCACCGCGGAGTGGAAGG - Intronic