ID: 967904150

View in Genome Browser
Species Human (GRCh38)
Location 3:194486936-194486958
Sequence GCGGCGCCCGATCACGCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 38}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967904140_967904150 -6 Left 967904140 3:194486919-194486941 CCCCCCTCCCCTCCGCGGCGGCG 0: 1
1: 0
2: 5
3: 50
4: 482
Right 967904150 3:194486936-194486958 GCGGCGCCCGATCACGCTGCGGG 0: 1
1: 0
2: 0
3: 5
4: 38
967904142_967904150 -8 Left 967904142 3:194486921-194486943 CCCCTCCCCTCCGCGGCGGCGCC 0: 1
1: 1
2: 12
3: 42
4: 412
Right 967904150 3:194486936-194486958 GCGGCGCCCGATCACGCTGCGGG 0: 1
1: 0
2: 0
3: 5
4: 38
967904129_967904150 30 Left 967904129 3:194486883-194486905 CCGAAACGGCCCCCCCGCCGCCA 0: 1
1: 0
2: 1
3: 9
4: 160
Right 967904150 3:194486936-194486958 GCGGCGCCCGATCACGCTGCGGG 0: 1
1: 0
2: 0
3: 5
4: 38
967904141_967904150 -7 Left 967904141 3:194486920-194486942 CCCCCTCCCCTCCGCGGCGGCGC 0: 1
1: 1
2: 5
3: 62
4: 485
Right 967904150 3:194486936-194486958 GCGGCGCCCGATCACGCTGCGGG 0: 1
1: 0
2: 0
3: 5
4: 38
967904130_967904150 21 Left 967904130 3:194486892-194486914 CCCCCCCGCCGCCAGCGACGTAG 0: 1
1: 0
2: 1
3: 5
4: 68
Right 967904150 3:194486936-194486958 GCGGCGCCCGATCACGCTGCGGG 0: 1
1: 0
2: 0
3: 5
4: 38
967904137_967904150 10 Left 967904137 3:194486903-194486925 CCAGCGACGTAGAGAACCCCCCT 0: 1
1: 0
2: 0
3: 2
4: 37
Right 967904150 3:194486936-194486958 GCGGCGCCCGATCACGCTGCGGG 0: 1
1: 0
2: 0
3: 5
4: 38
967904134_967904150 17 Left 967904134 3:194486896-194486918 CCCGCCGCCAGCGACGTAGAGAA 0: 1
1: 0
2: 0
3: 2
4: 36
Right 967904150 3:194486936-194486958 GCGGCGCCCGATCACGCTGCGGG 0: 1
1: 0
2: 0
3: 5
4: 38
967904143_967904150 -9 Left 967904143 3:194486922-194486944 CCCTCCCCTCCGCGGCGGCGCCC 0: 1
1: 0
2: 2
3: 35
4: 429
Right 967904150 3:194486936-194486958 GCGGCGCCCGATCACGCTGCGGG 0: 1
1: 0
2: 0
3: 5
4: 38
967904136_967904150 13 Left 967904136 3:194486900-194486922 CCGCCAGCGACGTAGAGAACCCC 0: 1
1: 0
2: 1
3: 3
4: 31
Right 967904150 3:194486936-194486958 GCGGCGCCCGATCACGCTGCGGG 0: 1
1: 0
2: 0
3: 5
4: 38
967904132_967904150 19 Left 967904132 3:194486894-194486916 CCCCCGCCGCCAGCGACGTAGAG 0: 1
1: 0
2: 1
3: 3
4: 57
Right 967904150 3:194486936-194486958 GCGGCGCCCGATCACGCTGCGGG 0: 1
1: 0
2: 0
3: 5
4: 38
967904144_967904150 -10 Left 967904144 3:194486923-194486945 CCTCCCCTCCGCGGCGGCGCCCG 0: 1
1: 1
2: 2
3: 50
4: 399
Right 967904150 3:194486936-194486958 GCGGCGCCCGATCACGCTGCGGG 0: 1
1: 0
2: 0
3: 5
4: 38
967904133_967904150 18 Left 967904133 3:194486895-194486917 CCCCGCCGCCAGCGACGTAGAGA 0: 1
1: 0
2: 0
3: 1
4: 23
Right 967904150 3:194486936-194486958 GCGGCGCCCGATCACGCTGCGGG 0: 1
1: 0
2: 0
3: 5
4: 38
967904131_967904150 20 Left 967904131 3:194486893-194486915 CCCCCCGCCGCCAGCGACGTAGA 0: 1
1: 0
2: 0
3: 1
4: 38
Right 967904150 3:194486936-194486958 GCGGCGCCCGATCACGCTGCGGG 0: 1
1: 0
2: 0
3: 5
4: 38
967904135_967904150 16 Left 967904135 3:194486897-194486919 CCGCCGCCAGCGACGTAGAGAAC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 967904150 3:194486936-194486958 GCGGCGCCCGATCACGCTGCGGG 0: 1
1: 0
2: 0
3: 5
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967904150 Original CRISPR GCGGCGCCCGATCACGCTGC GGG Intronic
904563397 1:31413335-31413357 GCGCCGCCCGTTCCTGCTGCGGG + Intronic
1064442953 10:15370552-15370574 GCGCCGCCCGATCGCGCTCCCGG - Intronic
1070327071 10:75396259-75396281 GCGGCGTCCGAAGACGCTGCGGG + Intergenic
1081528362 11:43942390-43942412 GCGGCCCCGGAGCACGCGGCTGG - Exonic
1096461158 12:51821932-51821954 GCGGCGCCCGAGTACGCGGCCGG - Intergenic
1105870961 13:24505950-24505972 GCGGAGCCCAATCGCGGTGCAGG - Intronic
1107551415 13:41479817-41479839 GCAGAGCCCGATCACTGTGCTGG + Intergenic
1119742897 14:77026012-77026034 GCGGCGCCGGGGCACGCGGCGGG - Exonic
1122635208 14:103126635-103126657 GCGGAGCCCGAGGACGCAGCCGG + Exonic
1124790034 15:32718438-32718460 GAGGCCCCCGAACACGCTCCTGG + Intronic
1126099577 15:45111410-45111432 GCGGCGCCCGACCCCGCCACCGG - Exonic
1126103950 15:45135627-45135649 GCGGCGCCCGACCCCGCCACCGG + Exonic
1132759045 16:1500143-1500165 GCGGCGCCCGCTCCTGCTGCAGG + Exonic
1135335744 16:21599724-21599746 GCGGCCCCCGATGAGACTGCTGG + Exonic
1148112086 17:45150228-45150250 GCGGCGCTCGCTCCTGCTGCCGG - Exonic
1152772534 17:82179125-82179147 GCTGCACCTGATCACGCTCCAGG + Exonic
1154270316 18:12912521-12912543 GCGGAGCCCGACCCCTCTGCGGG + Intronic
1163518529 19:17778953-17778975 GCAGGGCCTGATCAGGCTGCTGG + Intronic
943060429 2:183037736-183037758 CCAGCGCCCGATCCCGCCGCCGG + Intronic
948839649 2:240642646-240642668 GCGGCGCCCCCTCCCTCTGCTGG - Intergenic
1168757064 20:325401-325423 GCGGCGCCCGAGCGCGAGGCGGG + Exonic
1169217484 20:3801976-3801998 GATGGGCCGGATCACGCTGCAGG - Exonic
1169483512 20:6006481-6006503 GCGGCGCCCGCTCCGGCCGCTGG - Exonic
1171233781 20:23508585-23508607 GCGGCTCCCGTTCACCCTGTGGG - Intergenic
1183401791 22:37609091-37609113 GCGGCGCCCGCTCCCACCGCTGG - Intronic
1184775331 22:46620298-46620320 GCGGCGCCCGGCCAGGCTCCAGG - Intronic
952205940 3:31181605-31181627 GCGGCGTCGGATCAGGCAGCAGG - Intergenic
958718988 3:97822123-97822145 GCGGCGCCCGGTCGGGCTCCGGG + Exonic
967904150 3:194486936-194486958 GCGGCGCCCGATCACGCTGCGGG + Intronic
970333378 4:15005025-15005047 GCTCCGCCCGATCAACCTGCTGG + Intronic
981782917 4:148445677-148445699 GCGGCGCGCGGGCACGCGGCAGG + Intergenic
987379906 5:17275541-17275563 GCGGCCCCCGGCCCCGCTGCGGG + Exonic
995342020 5:111070894-111070916 GCGGAGCCAGACCGCGCTGCTGG - Intronic
1005566175 6:27097011-27097033 GAGGCGCCTGAGCAGGCTGCGGG - Intergenic
1022396038 7:29989203-29989225 GCGGCGCCCGCCCGCGCAGCAGG + Intronic
1025089654 7:56051718-56051740 GCGGCGCGCGGGCACGCTGGGGG + Exonic
1027059358 7:75073453-75073475 CCGGCGCCCGACCGCGCCGCAGG - Exonic
1034522823 7:151633057-151633079 GCGGCGCCCGTGCACTCTGCAGG - Intronic
1036706557 8:11051231-11051253 CTGGCCCCCGATCACCCTGCTGG + Intronic
1036769634 8:11570233-11570255 GAGGAGCCCGCTCACGCTGGGGG + Intergenic
1039455154 8:37701016-37701038 GCGCAGCCCGCTCTCGCTGCTGG - Intergenic
1061005731 9:127927660-127927682 GCGGCACCCGCACTCGCTGCTGG - Exonic
1186194928 X:7100296-7100318 GCAGCCCCTGATCATGCTGCAGG - Intronic
1190368124 X:49716779-49716801 GCCGCTCCCGATCAGGCTGGAGG + Intergenic