ID: 967904151

View in Genome Browser
Species Human (GRCh38)
Location 3:194486937-194486959
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 21
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 18}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967904136_967904151 14 Left 967904136 3:194486900-194486922 CCGCCAGCGACGTAGAGAACCCC 0: 1
1: 0
2: 1
3: 3
4: 31
Right 967904151 3:194486937-194486959 CGGCGCCCGATCACGCTGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 18
967904134_967904151 18 Left 967904134 3:194486896-194486918 CCCGCCGCCAGCGACGTAGAGAA 0: 1
1: 0
2: 0
3: 2
4: 36
Right 967904151 3:194486937-194486959 CGGCGCCCGATCACGCTGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 18
967904141_967904151 -6 Left 967904141 3:194486920-194486942 CCCCCTCCCCTCCGCGGCGGCGC 0: 1
1: 1
2: 5
3: 62
4: 485
Right 967904151 3:194486937-194486959 CGGCGCCCGATCACGCTGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 18
967904132_967904151 20 Left 967904132 3:194486894-194486916 CCCCCGCCGCCAGCGACGTAGAG 0: 1
1: 0
2: 1
3: 3
4: 57
Right 967904151 3:194486937-194486959 CGGCGCCCGATCACGCTGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 18
967904140_967904151 -5 Left 967904140 3:194486919-194486941 CCCCCCTCCCCTCCGCGGCGGCG 0: 1
1: 0
2: 5
3: 50
4: 482
Right 967904151 3:194486937-194486959 CGGCGCCCGATCACGCTGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 18
967904143_967904151 -8 Left 967904143 3:194486922-194486944 CCCTCCCCTCCGCGGCGGCGCCC 0: 1
1: 0
2: 2
3: 35
4: 429
Right 967904151 3:194486937-194486959 CGGCGCCCGATCACGCTGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 18
967904137_967904151 11 Left 967904137 3:194486903-194486925 CCAGCGACGTAGAGAACCCCCCT 0: 1
1: 0
2: 0
3: 2
4: 37
Right 967904151 3:194486937-194486959 CGGCGCCCGATCACGCTGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 18
967904144_967904151 -9 Left 967904144 3:194486923-194486945 CCTCCCCTCCGCGGCGGCGCCCG 0: 1
1: 1
2: 2
3: 50
4: 399
Right 967904151 3:194486937-194486959 CGGCGCCCGATCACGCTGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 18
967904135_967904151 17 Left 967904135 3:194486897-194486919 CCGCCGCCAGCGACGTAGAGAAC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 967904151 3:194486937-194486959 CGGCGCCCGATCACGCTGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 18
967904131_967904151 21 Left 967904131 3:194486893-194486915 CCCCCCGCCGCCAGCGACGTAGA 0: 1
1: 0
2: 0
3: 1
4: 38
Right 967904151 3:194486937-194486959 CGGCGCCCGATCACGCTGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 18
967904142_967904151 -7 Left 967904142 3:194486921-194486943 CCCCTCCCCTCCGCGGCGGCGCC 0: 1
1: 1
2: 12
3: 42
4: 412
Right 967904151 3:194486937-194486959 CGGCGCCCGATCACGCTGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 18
967904130_967904151 22 Left 967904130 3:194486892-194486914 CCCCCCCGCCGCCAGCGACGTAG 0: 1
1: 0
2: 1
3: 5
4: 68
Right 967904151 3:194486937-194486959 CGGCGCCCGATCACGCTGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 18
967904133_967904151 19 Left 967904133 3:194486895-194486917 CCCCGCCGCCAGCGACGTAGAGA 0: 1
1: 0
2: 0
3: 1
4: 23
Right 967904151 3:194486937-194486959 CGGCGCCCGATCACGCTGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type