ID: 967904154

View in Genome Browser
Species Human (GRCh38)
Location 3:194486945-194486967
Sequence GATCACGCTGCGGGGAGAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 121}

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967904143_967904154 0 Left 967904143 3:194486922-194486944 CCCTCCCCTCCGCGGCGGCGCCC 0: 1
1: 0
2: 2
3: 35
4: 429
Right 967904154 3:194486945-194486967 GATCACGCTGCGGGGAGAGCCGG 0: 1
1: 0
2: 0
3: 6
4: 121
967904132_967904154 28 Left 967904132 3:194486894-194486916 CCCCCGCCGCCAGCGACGTAGAG 0: 1
1: 0
2: 1
3: 3
4: 57
Right 967904154 3:194486945-194486967 GATCACGCTGCGGGGAGAGCCGG 0: 1
1: 0
2: 0
3: 6
4: 121
967904136_967904154 22 Left 967904136 3:194486900-194486922 CCGCCAGCGACGTAGAGAACCCC 0: 1
1: 0
2: 1
3: 3
4: 31
Right 967904154 3:194486945-194486967 GATCACGCTGCGGGGAGAGCCGG 0: 1
1: 0
2: 0
3: 6
4: 121
967904130_967904154 30 Left 967904130 3:194486892-194486914 CCCCCCCGCCGCCAGCGACGTAG 0: 1
1: 0
2: 1
3: 5
4: 68
Right 967904154 3:194486945-194486967 GATCACGCTGCGGGGAGAGCCGG 0: 1
1: 0
2: 0
3: 6
4: 121
967904145_967904154 -4 Left 967904145 3:194486926-194486948 CCCCTCCGCGGCGGCGCCCGATC 0: 1
1: 0
2: 0
3: 6
4: 77
Right 967904154 3:194486945-194486967 GATCACGCTGCGGGGAGAGCCGG 0: 1
1: 0
2: 0
3: 6
4: 121
967904137_967904154 19 Left 967904137 3:194486903-194486925 CCAGCGACGTAGAGAACCCCCCT 0: 1
1: 0
2: 0
3: 2
4: 37
Right 967904154 3:194486945-194486967 GATCACGCTGCGGGGAGAGCCGG 0: 1
1: 0
2: 0
3: 6
4: 121
967904144_967904154 -1 Left 967904144 3:194486923-194486945 CCTCCCCTCCGCGGCGGCGCCCG 0: 1
1: 1
2: 2
3: 50
4: 399
Right 967904154 3:194486945-194486967 GATCACGCTGCGGGGAGAGCCGG 0: 1
1: 0
2: 0
3: 6
4: 121
967904131_967904154 29 Left 967904131 3:194486893-194486915 CCCCCCGCCGCCAGCGACGTAGA 0: 1
1: 0
2: 0
3: 1
4: 38
Right 967904154 3:194486945-194486967 GATCACGCTGCGGGGAGAGCCGG 0: 1
1: 0
2: 0
3: 6
4: 121
967904147_967904154 -6 Left 967904147 3:194486928-194486950 CCTCCGCGGCGGCGCCCGATCAC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 967904154 3:194486945-194486967 GATCACGCTGCGGGGAGAGCCGG 0: 1
1: 0
2: 0
3: 6
4: 121
967904141_967904154 2 Left 967904141 3:194486920-194486942 CCCCCTCCCCTCCGCGGCGGCGC 0: 1
1: 1
2: 5
3: 62
4: 485
Right 967904154 3:194486945-194486967 GATCACGCTGCGGGGAGAGCCGG 0: 1
1: 0
2: 0
3: 6
4: 121
967904146_967904154 -5 Left 967904146 3:194486927-194486949 CCCTCCGCGGCGGCGCCCGATCA 0: 1
1: 0
2: 0
3: 3
4: 21
Right 967904154 3:194486945-194486967 GATCACGCTGCGGGGAGAGCCGG 0: 1
1: 0
2: 0
3: 6
4: 121
967904134_967904154 26 Left 967904134 3:194486896-194486918 CCCGCCGCCAGCGACGTAGAGAA 0: 1
1: 0
2: 0
3: 2
4: 36
Right 967904154 3:194486945-194486967 GATCACGCTGCGGGGAGAGCCGG 0: 1
1: 0
2: 0
3: 6
4: 121
967904140_967904154 3 Left 967904140 3:194486919-194486941 CCCCCCTCCCCTCCGCGGCGGCG 0: 1
1: 0
2: 5
3: 50
4: 482
Right 967904154 3:194486945-194486967 GATCACGCTGCGGGGAGAGCCGG 0: 1
1: 0
2: 0
3: 6
4: 121
967904142_967904154 1 Left 967904142 3:194486921-194486943 CCCCTCCCCTCCGCGGCGGCGCC 0: 1
1: 1
2: 12
3: 42
4: 412
Right 967904154 3:194486945-194486967 GATCACGCTGCGGGGAGAGCCGG 0: 1
1: 0
2: 0
3: 6
4: 121
967904133_967904154 27 Left 967904133 3:194486895-194486917 CCCCGCCGCCAGCGACGTAGAGA 0: 1
1: 0
2: 0
3: 1
4: 23
Right 967904154 3:194486945-194486967 GATCACGCTGCGGGGAGAGCCGG 0: 1
1: 0
2: 0
3: 6
4: 121
967904148_967904154 -9 Left 967904148 3:194486931-194486953 CCGCGGCGGCGCCCGATCACGCT 0: 1
1: 0
2: 0
3: 0
4: 25
Right 967904154 3:194486945-194486967 GATCACGCTGCGGGGAGAGCCGG 0: 1
1: 0
2: 0
3: 6
4: 121
967904135_967904154 25 Left 967904135 3:194486897-194486919 CCGCCGCCAGCGACGTAGAGAAC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 967904154 3:194486945-194486967 GATCACGCTGCGGGGAGAGCCGG 0: 1
1: 0
2: 0
3: 6
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967904154 Original CRISPR GATCACGCTGCGGGGAGAGC CGG Intronic
901035234 1:6332303-6332325 GGTCAGGCTGCGGGAGGAGCTGG + Intronic
903125550 1:21245097-21245119 GAGCAGGCTGCGGGGAGAGGAGG + Exonic
904684074 1:32248243-32248265 GATCAAGCTGAGGTGAGAGGGGG + Intronic
906209055 1:44002255-44002277 GATCAGGCTGCAGAGAGTGCAGG + Intronic
906615906 1:47232498-47232520 GAACGCGCTGCGGGGAGCGTTGG + Intergenic
907430154 1:54406707-54406729 GTCCACGCCGCGGGGAGCGCGGG - Intronic
910647015 1:89524977-89524999 GAGCACGCCGCGGGGAGCGCGGG + Exonic
914435664 1:147657291-147657313 AATCAGGCTGTGGGGAAAGCTGG - Intronic
915339141 1:155166884-155166906 GATGGGGCTGCGGGGAGTGCGGG - Intergenic
918200995 1:182266790-182266812 GATCAAGGTGCTGGGAGATCTGG - Intergenic
920516240 1:206586412-206586434 GGTCACACTGCTGGGAGAGGTGG + Intronic
922706701 1:227794163-227794185 GATGTGCCTGCGGGGAGAGCAGG + Intergenic
922814015 1:228436442-228436464 GATCACCCTGTGGGCAGCGCTGG + Intergenic
1064297224 10:14089450-14089472 CAGCATGCTGCGGGGAGGGCGGG - Intronic
1064375914 10:14795802-14795824 GATCACGGTGCTGGCAGATCTGG - Intergenic
1066656103 10:37701170-37701192 GGTGACGCTGCGGGAAGAACAGG - Intergenic
1066661085 10:37738718-37738740 GATCACGGTGTGGGAAGGGCTGG - Intergenic
1067967228 10:50926379-50926401 AATCAGGCTTCTGGGAGAGCAGG + Intergenic
1069567601 10:69474168-69474190 GAGCAGGCGGTGGGGAGAGCAGG - Intronic
1069813277 10:71178219-71178241 GATCCAGCTGCTGTGAGAGCAGG + Intergenic
1073464415 10:103685759-103685781 GATCACACAGCAGGCAGAGCCGG + Intronic
1082014842 11:47477307-47477329 GAGCACGCTGAGGGGACTGCTGG + Exonic
1083745817 11:64735920-64735942 GCTCCCGCTGCAGGGACAGCTGG + Exonic
1084684041 11:70683314-70683336 GAGCTCGCTGAGGTGAGAGCTGG - Intronic
1084904691 11:72336428-72336450 GATCACACAGCTGGGAGAGGCGG - Intronic
1089563317 11:119356916-119356938 AGTGACGCTGCGGAGAGAGCGGG + Exonic
1090207243 11:124892261-124892283 GATCACTCAGCTGGCAGAGCAGG + Intronic
1091305476 11:134533193-134533215 GTTCAGGCTGCAGGGAGAGTGGG + Intergenic
1100667371 12:96769581-96769603 GCTCACCCTGAAGGGAGAGCTGG - Intronic
1102831509 12:116005960-116005982 GATAATGCTGCTGGCAGAGCTGG - Exonic
1104917028 12:132271020-132271042 AATCAAGCAGAGGGGAGAGCAGG + Intronic
1108384896 13:49890440-49890462 GAGCCGGCTGCGGGGGGAGCTGG - Intergenic
1109126821 13:58528464-58528486 GAGCCGGCTGCGGGGGGAGCTGG - Intergenic
1110414819 13:75240464-75240486 GAGCCGGCTGCGGGGGGAGCTGG + Intergenic
1112574966 13:100627405-100627427 GATCACGGTGTGGGCAGGGCTGG + Intronic
1113457459 13:110458684-110458706 TATCAGGCAGCGGGGAGAGCTGG - Intronic
1113783161 13:112988044-112988066 GGTCAGGCTGCGGGGCGAGGAGG + Intronic
1116003364 14:39267308-39267330 GAGCCGGCTGCGGGGGGAGCTGG - Exonic
1121416134 14:93780339-93780361 GAGCTCGCTGAGGGCAGAGCAGG + Intronic
1121967687 14:98325680-98325702 CATCACTGTGCGGGGAGAGTGGG + Intergenic
1123653407 15:22494568-22494590 GATCACGCCGCGGCGGGAGGTGG - Intergenic
1124637157 15:31372646-31372668 GAACACGCTGGGGACAGAGCAGG + Exonic
1129867831 15:78922762-78922784 TAGGACGCTGCAGGGAGAGCAGG - Intronic
1130348036 15:83067022-83067044 GTTCCCGCTGCAGGGGGAGCAGG + Exonic
1130914272 15:88292230-88292252 GACCAGGCTGCTGGGAGAGGGGG + Intergenic
1130992080 15:88881597-88881619 GCACACGCCGCGGGGAGACCAGG + Exonic
1132943599 16:2520452-2520474 GCTCACGATGCGCGGCGAGCAGG + Exonic
1134834107 16:17347004-17347026 GATCACATTGAGGGGGGAGCCGG + Intronic
1139633847 16:68246236-68246258 GATCAAGGAGCGGGGTGAGCAGG - Intronic
1142006242 16:87690805-87690827 GAGCACGTTGCGGGGAGCGCAGG - Intronic
1142134274 16:88444476-88444498 GTTCACGCAGTGGGGAGAGGGGG + Intergenic
1142369136 16:89668513-89668535 GTTCAGGCTTCTGGGAGAGCAGG - Intronic
1142850722 17:2703524-2703546 GAGCACGTAGCGGGGAGAGAAGG + Intronic
1142930675 17:3281680-3281702 GATAACCCTGAAGGGAGAGCAGG + Intergenic
1145035269 17:19536302-19536324 GATCAGGCTACTGGGAGGGCTGG - Intronic
1145230936 17:21172689-21172711 GACCATGCTGAGGGGACAGCTGG - Intronic
1148896597 17:50842636-50842658 TGTCACGCTGGGGTGAGAGCAGG - Intergenic
1152621012 17:81364840-81364862 GCTCACACTGCGGGCAGCGCTGG - Intergenic
1154133953 18:11760100-11760122 GAGCGAGCTGCGGGGAGAGGAGG - Intronic
1154416156 18:14177089-14177111 GCCCACGGTGCGGGGAGAGGGGG - Intergenic
1157522497 18:48355034-48355056 GATGAAGCTGCAGGCAGAGCAGG - Intronic
1160672992 19:375086-375108 GACCACGCTGCAGGGAGGACGGG + Intronic
1161074456 19:2278647-2278669 GCTCACCCTGCGCAGAGAGCGGG - Exonic
1161453260 19:4358175-4358197 GAGCTCGCTGCGGGGCGGGCAGG + Intronic
1162066811 19:8131036-8131058 GATCAAGGTGCGGGCAGGGCTGG - Intronic
1164407991 19:27971723-27971745 GATGATGCTGGGGGGAAAGCTGG + Intergenic
1164551905 19:29219073-29219095 CCTCACTCTGCAGGGAGAGCTGG - Intergenic
1164624238 19:29715620-29715642 GCCCAGGCTGCGGGGAGAGAGGG - Intronic
1167473567 19:49688146-49688168 GGTCCCGCTGCAGGGAGAGGTGG - Exonic
1168184955 19:54694685-54694707 GATCATGCAGCAGGGATAGCTGG - Intronic
925368102 2:3324763-3324785 GGTCACGCCGGGGGGAGTGCAGG + Intronic
926155099 2:10448959-10448981 CAGCACGCTGCGGGCAGGGCTGG + Intergenic
927905105 2:26849642-26849664 GATCTCCCTTCGGGGAGACCCGG + Intronic
929030441 2:37645876-37645898 GATCAAGCTGCAGGGAGAGGAGG + Exonic
934861216 2:97764865-97764887 AACCATGCTGCCGGGAGAGCAGG - Intronic
937872376 2:126795415-126795437 AATCACGCTTCGGGGACTGCTGG + Intergenic
940888649 2:159013855-159013877 GATCAAGCTGTTGGCAGAGCTGG + Intronic
948011971 2:234656134-234656156 CATCAGGCTGGGGGGAGAGAGGG + Intergenic
1169257493 20:4110369-4110391 GCTCAGGCTGCAGGCAGAGCTGG - Intergenic
1171120907 20:22568345-22568367 GACCCCGCTGCGGTGGGAGCGGG - Intergenic
1173813791 20:45972048-45972070 GGTCACACTGCGGGGATACCCGG - Intronic
1176068740 20:63215338-63215360 GATCATGCGGTGGGGAGAGACGG + Intronic
1180087381 21:45514089-45514111 GAGCAGGCTGCGGAGGGAGCAGG + Exonic
1180966202 22:19789138-19789160 GACCACTCTGAGGGGAGGGCTGG - Intronic
1181278707 22:21703472-21703494 GTTCACCCTGCGGGGACAGAGGG + Exonic
1182049032 22:27299231-27299253 GACGACGCTGCCGGGAGGGCTGG + Intergenic
1183673894 22:39289373-39289395 GCTCACCCTGAGAGGAGAGCGGG + Intergenic
1184651155 22:45920044-45920066 GCTCAGGCTGCGGGGACAGGAGG - Intergenic
949697635 3:6717621-6717643 GATCAAGTTGCTGGCAGAGCTGG - Intergenic
951613959 3:24521847-24521869 GCTCCCGCCGCGGGGAGAGCGGG + Intergenic
954441818 3:50526264-50526286 GACCCTGCTGCGGGGAGGGCAGG - Intergenic
961628702 3:128281100-128281122 TATGGTGCTGCGGGGAGAGCAGG - Intronic
965600915 3:170453996-170454018 GACCACTCTGAGGGGAGAGATGG - Intronic
967089283 3:186121687-186121709 GTTCAGTCTGCAGGGAGAGCTGG + Intronic
967904154 3:194486945-194486967 GATCACGCTGCGGGGAGAGCCGG + Intronic
969204138 4:5629797-5629819 GATCCCGCTAGGTGGAGAGCAGG - Intronic
969513450 4:7632732-7632754 GATCACGGTGCTGGGAGAAATGG + Intronic
969590746 4:8120566-8120588 GATCAAGGTGCGGGCAGGGCTGG - Intronic
970328823 4:14957549-14957571 GATCAAGGTGTGGGCAGAGCTGG - Intergenic
974660519 4:64882476-64882498 GATCAAGATGCAGGCAGAGCAGG + Intergenic
976110981 4:81673547-81673569 GACCACACTGCGGGGACCGCAGG + Intronic
992320856 5:75611854-75611876 AATCAGGCTGCGGGGCGGGCTGG + Intronic
998952175 5:147403444-147403466 GATCTCCCAGCTGGGAGAGCTGG - Intronic
1001162663 5:169335355-169335377 GATCACACTGCTATGAGAGCTGG + Intergenic
1005116156 6:22339886-22339908 GAACACACTGCGGGGAGTGGTGG - Intergenic
1006188113 6:32191864-32191886 GTTCAGTCTGCAGGGAGAGCAGG + Exonic
1008528035 6:52427292-52427314 GATGAGGCTGGGGAGAGAGCAGG - Intronic
1015306205 6:131711141-131711163 GAGCGGGCTGCGGGGGGAGCTGG + Intronic
1016657910 6:146543281-146543303 GCTCTCCCTGCGGGGAGAGTAGG + Intergenic
1017683075 6:156883611-156883633 GATCATGCTGTGGGGAGCGTGGG - Intronic
1019150361 6:170001448-170001470 GATCACGCTGATGGAAGAGGTGG + Intergenic
1020071828 7:5232285-5232307 GGTCACGCTGGGCGAAGAGCTGG + Exonic
1033678777 7:143571672-143571694 GAGCGGGCTGCGGGGGGAGCTGG - Intergenic
1033693060 7:143757782-143757804 GAGCGGGCTGCGGGGGGAGCTGG + Intergenic
1033731345 7:144183358-144183380 GAGCGGGCTGCGGGGGGAGCTGG - Intergenic
1033740319 7:144269374-144269396 GAGCGGGCTGCGGGGGGAGCTGG + Intergenic
1033932196 7:146537838-146537860 GATGACACTGGGGAGAGAGCAGG + Intronic
1035108576 7:156462080-156462102 GCTTACTCTGGGGGGAGAGCAGG + Intergenic
1037769531 8:21790165-21790187 GGTCACGTTCCGGCGAGAGCGGG + Intronic
1038634019 8:29271043-29271065 TATTATGTTGCGGGGAGAGCTGG - Intergenic
1048334562 8:133492891-133492913 GATCACTTTGTGGGGAGAGTGGG - Intronic
1050648345 9:7746701-7746723 GATCAAGCTGCTGGCAGATCTGG - Intergenic
1052633616 9:31071841-31071863 GAGCAGGCTGCCGGGAAAGCAGG + Intergenic
1056954723 9:91072887-91072909 TCTCACCCTGCAGGGAGAGCTGG - Intergenic
1058420634 9:104829918-104829940 GATCAGGATGCGGGAGGAGCTGG - Intronic
1060527806 9:124330408-124330430 AATCACGGGGCTGGGAGAGCGGG + Intronic
1186063646 X:5738443-5738465 GATCAAGGTGTGGGCAGAGCTGG + Intergenic
1202600908 Y:26592148-26592170 GACCACACTGCAGGTAGAGCAGG - Intergenic