ID: 967904279

View in Genome Browser
Species Human (GRCh38)
Location 3:194487513-194487535
Sequence GGACTCTGCGCCCCGGCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 155}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967904270_967904279 30 Left 967904270 3:194487460-194487482 CCTCGCCCCCGCCAAAACAAACA 0: 1
1: 0
2: 15
3: 143
4: 841
Right 967904279 3:194487513-194487535 GGACTCTGCGCCCCGGCCGCAGG 0: 1
1: 0
2: 1
3: 11
4: 155
967904273_967904279 23 Left 967904273 3:194487467-194487489 CCCGCCAAAACAAACAGACAAAA 0: 1
1: 3
2: 62
3: 345
4: 2540
Right 967904279 3:194487513-194487535 GGACTCTGCGCCCCGGCCGCAGG 0: 1
1: 0
2: 1
3: 11
4: 155
967904274_967904279 22 Left 967904274 3:194487468-194487490 CCGCCAAAACAAACAGACAAAAA 0: 1
1: 30
2: 214
3: 979
4: 4860
Right 967904279 3:194487513-194487535 GGACTCTGCGCCCCGGCCGCAGG 0: 1
1: 0
2: 1
3: 11
4: 155
967904271_967904279 25 Left 967904271 3:194487465-194487487 CCCCCGCCAAAACAAACAGACAA 0: 1
1: 1
2: 37
3: 267
4: 3152
Right 967904279 3:194487513-194487535 GGACTCTGCGCCCCGGCCGCAGG 0: 1
1: 0
2: 1
3: 11
4: 155
967904275_967904279 19 Left 967904275 3:194487471-194487493 CCAAAACAAACAGACAAAAAACT 0: 2
1: 20
2: 121
3: 530
4: 2594
Right 967904279 3:194487513-194487535 GGACTCTGCGCCCCGGCCGCAGG 0: 1
1: 0
2: 1
3: 11
4: 155
967904272_967904279 24 Left 967904272 3:194487466-194487488 CCCCGCCAAAACAAACAGACAAA 0: 1
1: 1
2: 42
3: 383
4: 3722
Right 967904279 3:194487513-194487535 GGACTCTGCGCCCCGGCCGCAGG 0: 1
1: 0
2: 1
3: 11
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967904279 Original CRISPR GGACTCTGCGCCCCGGCCGC AGG Intronic
902793384 1:18784417-18784439 GGGCTCGGCGCCGCGGCCGACGG + Intergenic
903071801 1:20730462-20730484 GGCCTCTGCACCCCCACCGCTGG - Intronic
905354656 1:37372933-37372955 GAACGATGCGCCCGGGCCGCCGG - Intergenic
905752368 1:40477273-40477295 GGGTTGTGAGCCCCGGCCGCCGG - Exonic
910625488 1:89302765-89302787 GGACCCTGCGCCAGGGCTGCAGG + Intergenic
911449569 1:98046056-98046078 GGCCGCTGCCCCCCTGCCGCTGG + Intergenic
912471639 1:109910933-109910955 GGAGTGGGCGCCCCGGCCGAGGG - Exonic
918458743 1:184754614-184754636 GGACCCACAGCCCCGGCCGCCGG + Exonic
919931197 1:202222447-202222469 AGGCTCTGCGGCCCGGCCCCTGG + Intronic
920494908 1:206447779-206447801 GGTCTCTGTGCCCCGGGCACTGG - Intronic
1063930003 10:11018584-11018606 GGACTCCGCGCCCGGCTCGCCGG - Intronic
1065053619 10:21820637-21820659 GGACTCTGGGCCCAGTCCCCAGG + Intronic
1065637453 10:27745626-27745648 GGCCCCTGCGCCCTGGGCGCCGG - Intronic
1067497776 10:46774938-46774960 GGTCGCTGGGCCCGGGCCGCCGG + Intergenic
1067596873 10:47565476-47565498 GGTCGCTGGGCCCGGGCCGCCGG - Intergenic
1069784259 10:70977780-70977802 GTCCTCTGCTCCCCGGCCTCAGG + Intergenic
1075025408 10:118980153-118980175 GGACACTGGGCCCCAGCTGCAGG + Intergenic
1076373786 10:129970663-129970685 GGACTCCCCGGCCCGGCCGCCGG - Intergenic
1076838365 10:133032506-133032528 GCCCTCTGCGCCCAGGCCTCTGG - Intergenic
1080406875 11:31987512-31987534 GGACTCGGCGCGCGGGGCGCGGG - Intronic
1081773980 11:45665448-45665470 GGTCCCTGAGCCCCGGCCCCGGG - Exonic
1085043971 11:73342954-73342976 GAGCGCTGCGGCCCGGCCGCCGG - Intronic
1085640285 11:78188922-78188944 CGACTCTGCGGCGCGGCCCCGGG - Exonic
1086484713 11:87286464-87286486 GGACCCTGCGCCAGGGCCACGGG + Intronic
1089190787 11:116651826-116651848 CGACTCTGCTCCTCGGCCGAGGG - Intergenic
1089346751 11:117796182-117796204 GTACGCAGCGCCCCAGCCGCAGG + Intronic
1089466328 11:118688920-118688942 GGATTCCGCACCCCGGCTGCAGG + Intergenic
1091308174 11:134554164-134554186 GGAGTCTGCACCCTGGCAGCAGG - Intergenic
1093164509 12:15789525-15789547 GAACTCTGCGGCTCGGCTGCCGG - Exonic
1096841004 12:54379184-54379206 GGGCTGTGCGGCCCGGCCGGCGG + Intronic
1101910476 12:108857368-108857390 GGACGCCGCGCCGAGGCCGCCGG - Intronic
1102309837 12:111836069-111836091 GGATCCTGCACCCGGGCCGCAGG - Intergenic
1103416092 12:120742151-120742173 GGACTCTGCCCCCGGGCCACTGG + Intergenic
1103960799 12:124607957-124607979 TCACTCTGCGCCCTGGCCACGGG - Intergenic
1104841587 12:131828458-131828480 GGACCCTGCACGCCGCCCGCGGG + Exonic
1104927837 12:132322738-132322760 GGGCTCTGCGCCCGGTCCCCTGG - Intronic
1104961247 12:132489666-132489688 GGACTGGGGTCCCCGGCCGCGGG - Exonic
1105454251 13:20525806-20525828 GGACGCGGCGCCGCGGGCGCTGG + Exonic
1106116677 13:26823738-26823760 GGACTCTGCCACCAGGCCCCGGG + Intergenic
1112282625 13:98076279-98076301 GGATCCTGCACCCGGGCCGCAGG + Intergenic
1112319446 13:98393892-98393914 GGCCTCTGAGCCCAGGCTGCCGG - Intronic
1115118367 14:29909428-29909450 GGATCCTGCACCCAGGCCGCAGG - Intronic
1116186634 14:41607058-41607080 GAACACAGCGCCCCGCCCGCTGG - Intergenic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1122959778 14:105089206-105089228 GGACACTGGGCCCCCGCCCCAGG + Intergenic
1129382853 15:75178697-75178719 GGCCTCAGGGACCCGGCCGCTGG - Intergenic
1130076454 15:80694860-80694882 GGGCTCTGCGCCCGGACAGCTGG - Intronic
1131912671 15:97224663-97224685 GGATTCCGCGCCGGGGCCGCGGG - Intergenic
1132662040 16:1065942-1065964 GGACCCGCCGCCGCGGCCGCAGG - Intergenic
1132710719 16:1265916-1265938 GGACCCTGCCTCCCGGCAGCTGG - Intergenic
1132869291 16:2108560-2108582 GCGCTGGGCGCCCCGGCCGCTGG + Exonic
1133280035 16:4659995-4660017 GGTCTCTGCGGCCTGGCTGCAGG - Intronic
1133367460 16:5221954-5221976 GGATTCTGCACCGGGGCCGCAGG + Intergenic
1134441448 16:14301901-14301923 GGGCTCTGCCCCCCGCCCCCAGG + Intergenic
1134490743 16:14693897-14693919 GGACTCTGCGCCCCTGGGGAAGG + Intronic
1134496124 16:14733015-14733037 GGACTCTGCGCCCCTGGGGAAGG + Intronic
1134644757 16:15857259-15857281 GGAGTCTCAGCCCCGGCCCCAGG + Intergenic
1136172616 16:28497815-28497837 GGCCTCTGCCCTCCGGCCCCCGG - Exonic
1137531755 16:49282386-49282408 GCGCCCTGCACCCCGGCCGCCGG - Intergenic
1137787651 16:51151633-51151655 GGACTCCGCGGCCCGGCCGCCGG + Intergenic
1138446124 16:57065258-57065280 GAAGTCTGCGCCCAGGCCTCAGG + Exonic
1139848595 16:69937259-69937281 GGACCCTGAGCCCCTGCCTCTGG + Intronic
1141170078 16:81685408-81685430 GGACTATGAGCCCCAGCAGCAGG - Intronic
1141719773 16:85749938-85749960 GGGTTCTGCGCCCCCACCGCTGG - Intronic
1142496015 17:306733-306755 GGACTCTGTGTGCCGGGCGCAGG - Intronic
1142585119 17:967347-967369 TGTCTCTGCGCCCTGGCCTCTGG - Intronic
1143000715 17:3793474-3793496 GGAGTCTGGGCTCCGGCCCCAGG - Intronic
1143000935 17:3794680-3794702 GGAGTCTGGGCTCCGGCCCCGGG + Intronic
1143237938 17:5419372-5419394 GGGCTCTTCGCCGCCGCCGCTGG + Exonic
1143419234 17:6776118-6776140 GGGCTCTGCGACCCGGGGGCAGG + Intergenic
1144772919 17:17769806-17769828 GGACCCTGCACCCCGGCCAGAGG + Intronic
1147339882 17:39746966-39746988 GGACTCTGGGGCGCGGCCACAGG + Exonic
1148562580 17:48614339-48614361 GGCCTCCTCGCCCAGGCCGCTGG + Exonic
1150388793 17:64779544-64779566 GGAGCCTGCGCCCCGGCCCCGGG + Intergenic
1150790656 17:68198380-68198402 GGAGCCTGCGCCCCGGCCCCTGG - Intergenic
1151657460 17:75502562-75502584 GGGCACTGCGTCCTGGCCGCCGG + Exonic
1152699727 17:81812967-81812989 GCACACTGCGCCCCGGGCGGGGG - Intronic
1154303969 18:13217703-13217725 GGACGCGGCGCTGCGGCCGCCGG - Intronic
1155507829 18:26549170-26549192 GCCCGCTGCGCCCTGGCCGCGGG - Exonic
1157210143 18:45735284-45735306 GGCATCTGCTCCCCGGCCCCAGG + Intronic
1160025432 18:75211798-75211820 GGACGCGGGGCCCCGGGCGCGGG - Intronic
1160773250 19:843303-843325 GGACTCAGCGCCCAGGCCGGGGG - Intronic
1160935425 19:1592439-1592461 GGCCTCGGCGCCCCTGCCCCGGG - Intronic
1161015504 19:1980927-1980949 GGAGGCTGCGCCCCGGCGCCTGG + Exonic
1161321156 19:3642129-3642151 TGACTCAGTGTCCCGGCCGCCGG + Intronic
1162128235 19:8510865-8510887 GGGCGCGGCGGCCCGGCCGCGGG + Exonic
1162128447 19:8511650-8511672 GGCCGCTGCACCCGGGCCGCCGG - Exonic
1162334543 19:10052442-10052464 GGATTCTGAGCCCCAGCCCCGGG + Intergenic
1163458021 19:17420192-17420214 GGCCTCTGCACCCCCGCCGCGGG + Exonic
1165448586 19:35869719-35869741 GGGACCTGCGCACCGGCCGCTGG + Exonic
1166547040 19:43639886-43639908 GGCCTCGGCGCCCCGCCCCCGGG - Intergenic
1167134619 19:47609345-47609367 GGGCGCTGCGCCCCGGCTGGGGG - Intronic
1167638357 19:50667699-50667721 GGACCCTGCGCGCCGGGAGCTGG - Exonic
925052157 2:824225-824247 GGTCTCTGCGCCCACACCGCTGG - Intergenic
927759820 2:25742926-25742948 GCTCTCTGAGCCCCGGCCGTAGG + Exonic
935594273 2:104867454-104867476 GGGCTCTGCGTCCCGGGAGCTGG - Intergenic
936556777 2:113503430-113503452 GGCCTCTGCGCCACCGCCCCCGG + Intergenic
939869042 2:147507005-147507027 GCACTCTGAGCCGCGGGCGCCGG + Intergenic
946248813 2:218401063-218401085 GGACACTGGCCCCAGGCCGCGGG + Intronic
947219899 2:227782034-227782056 GGACTCTGCCCCCTTGCCACTGG + Intergenic
1172620030 20:36312729-36312751 GGACTCTGCACCCCGGGTGCTGG + Intronic
1175311739 20:58017266-58017288 GGACTCAGCCACCCGGCCCCGGG + Intergenic
1175869415 20:62201192-62201214 GGTCTCTGGGCCCCGCCTGCTGG + Exonic
1181083759 22:20429902-20429924 GGACCCTGGGCCCTGGCCGCGGG - Intronic
1182296989 22:29315692-29315714 GGAGTCGCCGCCCCAGCCGCCGG + Exonic
1182475602 22:30574808-30574830 CAACGCTGCGCCCCCGCCGCCGG + Intergenic
1183208424 22:36434838-36434860 GGACTCTGCACCCCTAGCGCAGG - Intergenic
1183437118 22:37802691-37802713 GGCCTCTGCGCCCAAGCCCCAGG + Intergenic
1183438303 22:37808011-37808033 TGACTGTGCGCGGCGGCCGCGGG - Exonic
1184481892 22:44752789-44752811 GGAGGCTGCGCGCCGGCCGGAGG - Intronic
1185074653 22:48676701-48676723 GGACTCTGCGGCCGGGGAGCGGG + Intronic
1185314003 22:50170963-50170985 GCGCCCCGCGCCCCGGCCGCCGG - Intronic
950773554 3:15331796-15331818 GGACTCTGCACCCGGGGCACCGG + Intronic
952076377 3:29701956-29701978 GGATCCCGCGCCACGGCCGCGGG - Intronic
956467665 3:69535634-69535656 GGTCTCTCCGCCCCTGCCTCCGG + Intronic
957193488 3:77039683-77039705 GGACTCGGCCACCCGCCCGCTGG - Intronic
961775209 3:129279253-129279275 GGATTCTGCACCCCGGCCCCGGG + Intronic
967904279 3:194487513-194487535 GGACTCTGCGCCCCGGCCGCAGG + Intronic
968653883 4:1770465-1770487 GGACCCCGTGCCCGGGCCGCAGG - Intergenic
969607581 4:8210226-8210248 GGGCTCTGCTCCCCGGCCCAGGG - Intronic
972245918 4:37245109-37245131 AGACTCTGCGCTCCGGCGGGCGG + Exonic
973759065 4:54100577-54100599 GGCCCCTGCGCCCCCGCTGCCGG - Exonic
975578500 4:75886334-75886356 GGACTCTCCGCACCGGCCTCGGG - Intronic
975991862 4:80266443-80266465 AGAACCTGCGCCCCGGACGCTGG - Intergenic
980130399 4:128811709-128811731 GGCCGCTGCGCCCCCGCCCCGGG + Intronic
984778410 4:183504297-183504319 GGACTGCGCGCCCCGGCGGGCGG - Intergenic
985692807 5:1323093-1323115 GGCCTCTGCTGCCCGGCCGGGGG - Intronic
989577329 5:43000502-43000524 CGACTCTGCGCCCCGCCTCCAGG - Intergenic
990320723 5:54627680-54627702 GGAATCTGCACCCCTGCCACTGG - Intergenic
992391208 5:76332275-76332297 GGACTTTGCACCCCTGCTGCTGG - Intronic
995462821 5:112420257-112420279 GCACACTGCGCCCAAGCCGCGGG + Intergenic
998364300 5:141618876-141618898 GGAGCCTGGGGCCCGGCCGCGGG - Exonic
999809639 5:155115213-155115235 GGATCCTGCGCCAAGGCCGCAGG - Intergenic
1001704322 5:173730825-173730847 GGACCCTCCGCCCCCGCCACCGG + Intergenic
1002259725 5:177984821-177984843 GGTCTCGGCGCCCCGGCCCAGGG + Intergenic
1004200342 6:13541958-13541980 GGATCCTGCACCCTGGCCGCAGG - Intergenic
1004607246 6:17206373-17206395 GGATCCTGCGCCTGGGCCGCGGG + Intergenic
1005746092 6:28838970-28838992 GGGCTCAGCACCCCGGCCCCCGG - Intergenic
1005766392 6:29015498-29015520 GGATCCTGCACCCGGGCCGCAGG - Intergenic
1011470230 6:87701424-87701446 GGACCCGGCCCCGCGGCCGCCGG - Intronic
1013155333 6:107488140-107488162 GGGCTCTGAGACCCGGCCACAGG + Intergenic
1013656666 6:112253945-112253967 GGACACTGTACCTCGGCCGCAGG + Exonic
1018020985 6:159762151-159762173 GGACTCTGCGCGGCTCCCGCCGG - Intronic
1019110158 6:169702752-169702774 GGACACGGCGTCCGGGCCGCAGG - Exonic
1019197146 6:170289557-170289579 GGAGTCGGCGCCCCCGCCGTCGG + Exonic
1019279562 7:193017-193039 GGACCCAGCGCTCCGGCGGCGGG + Exonic
1020106471 7:5424375-5424397 GCACTCCGGGCCCCGGCCCCCGG + Intronic
1021510448 7:21427859-21427881 GGCCCCAGCGCCCCGGCCCCCGG + Intergenic
1021992595 7:26152436-26152458 GGTCCCGGCGCCCCAGCCGCCGG - Exonic
1023057417 7:36301159-36301181 GGACTCAGCTCCCCAGCCTCTGG - Exonic
1023873250 7:44273899-44273921 GGACTGTGCTCCCTGGCCTCGGG - Intronic
1024505696 7:50159358-50159380 GGAGTCTGCGCCGCGGCTGGCGG - Exonic
1026968582 7:74454696-74454718 GGACCCCCCGCCCCGGCCCCGGG + Intronic
1027152061 7:75739582-75739604 CCACGCTGCGCCCCGCCCGCGGG - Intergenic
1031406694 7:121395853-121395875 GCACTCGGCGCCCCGGCCTGGGG - Intronic
1033165467 7:139035608-139035630 GGACTGTGGGCGCTGGCCGCGGG - Intronic
1041726590 8:61023714-61023736 GGAGGCTGCGCGCCGGCCCCAGG + Intergenic
1042137352 8:65644951-65644973 AGTCTCTGCCTCCCGGCCGCGGG - Intronic
1049896240 9:113908-113930 GGCCTCTGCGCCGCCGCCCCCGG - Intergenic
1053149164 9:35732085-35732107 TGGCTCTGCGCCCCGCCCGCCGG + Exonic
1053372724 9:37576234-37576256 GGAGTCCGGGCCGCGGCCGCCGG + Exonic
1056126231 9:83538383-83538405 GCCCGCCGCGCCCCGGCCGCTGG - Exonic
1058950412 9:109898224-109898246 GTACTCTGCGCACCTGCCCCAGG + Intronic
1059441301 9:114308560-114308582 GGACTGTGAGCTCTGGCCGCAGG - Intronic
1059447478 9:114347753-114347775 GGAGTCTGCTGGCCGGCCGCGGG + Exonic
1061811323 9:133164023-133164045 GGATCCTGCTCCCAGGCCGCAGG - Intergenic
1062325694 9:136011544-136011566 GGCCTCCGGGCCGCGGCCGCCGG + Exonic
1062524236 9:136971867-136971889 GGACACTGCTGCCCGGCCCCAGG - Exonic