ID: 967912872

View in Genome Browser
Species Human (GRCh38)
Location 3:194556474-194556496
Sequence CCATTGCTAGGGAGCACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967912872_967912879 21 Left 967912872 3:194556474-194556496 CCTCCTGTGCTCCCTAGCAATGG No data
Right 967912879 3:194556518-194556540 ACAGAAGCAAACAGAAGTTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967912872 Original CRISPR CCATTGCTAGGGAGCACAGG AGG (reversed) Intergenic
No off target data available for this crispr