ID: 967916772

View in Genome Browser
Species Human (GRCh38)
Location 3:194584146-194584168
Sequence CATCCACGATCGTGCCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967916772_967916783 23 Left 967916772 3:194584146-194584168 CCCCTCTGGCACGATCGTGGATG No data
Right 967916783 3:194584192-194584214 AAAGGCAGCGCCCCCGACTCTGG No data
967916772_967916782 5 Left 967916772 3:194584146-194584168 CCCCTCTGGCACGATCGTGGATG No data
Right 967916782 3:194584174-194584196 CCTGGCAACTGAAATGGGAAAGG No data
967916772_967916777 0 Left 967916772 3:194584146-194584168 CCCCTCTGGCACGATCGTGGATG No data
Right 967916777 3:194584169-194584191 AACCCCCTGGCAACTGAAATGGG No data
967916772_967916786 30 Left 967916772 3:194584146-194584168 CCCCTCTGGCACGATCGTGGATG No data
Right 967916786 3:194584199-194584221 GCGCCCCCGACTCTGGGGACTGG No data
967916772_967916785 25 Left 967916772 3:194584146-194584168 CCCCTCTGGCACGATCGTGGATG No data
Right 967916785 3:194584194-194584216 AGGCAGCGCCCCCGACTCTGGGG No data
967916772_967916784 24 Left 967916772 3:194584146-194584168 CCCCTCTGGCACGATCGTGGATG No data
Right 967916784 3:194584193-194584215 AAGGCAGCGCCCCCGACTCTGGG No data
967916772_967916776 -1 Left 967916772 3:194584146-194584168 CCCCTCTGGCACGATCGTGGATG No data
Right 967916776 3:194584168-194584190 GAACCCCCTGGCAACTGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967916772 Original CRISPR CATCCACGATCGTGCCAGAG GGG (reversed) Intergenic
No off target data available for this crispr