ID: 967917647

View in Genome Browser
Species Human (GRCh38)
Location 3:194590675-194590697
Sequence CTGGCTAAAAACACTGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 262}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967917644_967917647 -5 Left 967917644 3:194590657-194590679 CCAGAAGCACCCAGGCTGCTGGC 0: 1
1: 0
2: 6
3: 27
4: 257
Right 967917647 3:194590675-194590697 CTGGCTAAAAACACTGATGCTGG 0: 1
1: 0
2: 0
3: 29
4: 262
967917640_967917647 4 Left 967917640 3:194590648-194590670 CCAGCCACACCAGAAGCACCCAG 0: 1
1: 0
2: 1
3: 27
4: 388
Right 967917647 3:194590675-194590697 CTGGCTAAAAACACTGATGCTGG 0: 1
1: 0
2: 0
3: 29
4: 262
967917642_967917647 0 Left 967917642 3:194590652-194590674 CCACACCAGAAGCACCCAGGCTG 0: 1
1: 0
2: 3
3: 29
4: 331
Right 967917647 3:194590675-194590697 CTGGCTAAAAACACTGATGCTGG 0: 1
1: 0
2: 0
3: 29
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967917647 Original CRISPR CTGGCTAAAAACACTGATGC TGG Intronic
902445913 1:16464180-16464202 CTGACTAAAAGCATGGATGCTGG - Intergenic
903783799 1:25842513-25842535 CTAGCTAAGATCACTGATGAAGG + Intronic
905260954 1:36718774-36718796 CTGGCTAAGATCATTGATGAAGG - Intergenic
906445999 1:45898632-45898654 CTGGCAAATGAGACTGATGCCGG - Intronic
906889441 1:49692052-49692074 CTGGCGAAAAACAATCATGGGGG - Intronic
907223188 1:52921900-52921922 CAGGATTAAAACACTGACGCTGG - Intronic
908849605 1:68362296-68362318 CTGGCTAAGATCATTGATGAAGG - Intergenic
913415360 1:118599505-118599527 CTGGCTAAAATGACTGAGGCTGG + Intergenic
914774517 1:150724086-150724108 CTAGCTAAGATAACTGATGCAGG - Intergenic
915867181 1:159515191-159515213 CTGGGTATAAGCACTGATGCAGG + Intergenic
915985491 1:160460204-160460226 CTGGCCAATCACAATGATGCTGG + Intergenic
916553082 1:165868468-165868490 CTAGCTAAAATAACTGATGAAGG - Intronic
916847119 1:168662772-168662794 CTAGCTAAGATCACTGATGAAGG + Intergenic
917192353 1:172431591-172431613 CTAGCTAAGAACATTGATGCAGG + Intronic
921276149 1:213522607-213522629 CCAGCTAAAATCACTGATGGAGG - Intergenic
921379449 1:214509243-214509265 CTAGCTAAGATCACTGATGAAGG - Intronic
922796941 1:228344893-228344915 CTGGCTAATCTGACTGATGCTGG + Intronic
924556493 1:245123395-245123417 CTTGCTAGAAAAACTGAGGCAGG + Intronic
1063905765 10:10778661-10778683 CTGGCTAATAGCATTGATTCTGG + Intergenic
1065687253 10:28298786-28298808 CTAGCTAAGATCACTGATGAAGG - Intronic
1066285440 10:33961721-33961743 CTAGCTAAGATCACTGATGAAGG - Intergenic
1067301813 10:45018435-45018457 CTAGCTAAGATCACTGATGAAGG - Intergenic
1069087105 10:64153555-64153577 CTAGCTAAGATCACTGATGAAGG - Intergenic
1069620572 10:69835016-69835038 CTGGCTAGAAGCACTGAGGTGGG + Intronic
1070360877 10:75687631-75687653 CTGGCTAAGATCATTGATGAAGG + Intronic
1070383362 10:75901953-75901975 CTGGGTCAAAACCCTGAGGCTGG - Intronic
1072484305 10:95840286-95840308 CTTGTTAAAAACACAGATGATGG + Intronic
1073806504 10:107104421-107104443 TTGGCTAGAAACACTGTTTCAGG - Intronic
1073889817 10:108088034-108088056 CTGGCTATAAATATTAATGCAGG + Intergenic
1075596560 10:123734704-123734726 CTAGCTAAGACCACTGATGAAGG + Intronic
1076276358 10:129202512-129202534 CCAGCTAAAAGCACTGATGAAGG - Intergenic
1078193608 11:9115317-9115339 CTAGCTAAGATCACTGATGAAGG - Intronic
1079658811 11:23016080-23016102 CTAGCTCAAAACACACATGCAGG + Intergenic
1081071512 11:38616042-38616064 CTAGCTAAGATCACTGATGGAGG - Intergenic
1087123743 11:94601657-94601679 CAGTCTTAAAACACAGATGCAGG - Intronic
1087236726 11:95727661-95727683 CGTGCCAAAACCACTGATGCGGG - Intergenic
1088439631 11:109855410-109855432 CTAGCTAAGATCACTGATGAAGG - Intergenic
1089327716 11:117668808-117668830 CTTGCCTAAAACTCTGATGCTGG + Intronic
1089715910 11:120359057-120359079 CTGGCTAAAATCACTCACTCAGG - Intronic
1089967520 11:122665492-122665514 CTGTCCAAAAACACTGGTCCAGG - Intronic
1090147832 11:124345674-124345696 CTAGCTAAGATCACTGATGAAGG + Intergenic
1090218164 11:124989628-124989650 CTAGCTAAGATCACTGATGAAGG - Intronic
1090260782 11:125317955-125317977 CTAGCTAAGATCACTGATGAAGG - Intronic
1093402083 12:18758643-18758665 CTAGCTAAGATCATTGATGCAGG + Intergenic
1093427593 12:19045963-19045985 CTGGCTAAGATCATTGATGAAGG + Intergenic
1099592443 12:84612161-84612183 CTAGCTAAAATCATTGATGAAGG + Intergenic
1099716584 12:86302126-86302148 CTGGAGCAAAACACTGATTCTGG - Intronic
1101483261 12:105123721-105123743 CTGGCTAAAATCACTGATAGAGG + Intronic
1101620533 12:106382974-106382996 CTGGCTAAGATCACTGATGAAGG - Intronic
1102256228 12:111416818-111416840 ATGGCTAAGAACACAGATTCTGG - Intronic
1102595669 12:113990860-113990882 CTGGCTAAATACACATATGGGGG + Intergenic
1104617153 12:130280351-130280373 CTGGTTAAAAGCACTGTTGTTGG + Intergenic
1105324994 13:19362675-19362697 CTAGCTAAGATCATTGATGCAGG - Intergenic
1105780111 13:23698351-23698373 CTAGCTAAGAGCATTGATGCAGG + Intergenic
1105868290 13:24480871-24480893 CTAGCTAAGATCATTGATGCAGG + Intronic
1106456524 13:29932564-29932586 CTAGCTAAGATCACTGATGGAGG - Intergenic
1106989377 13:35398976-35398998 CTAGCTAAGATCACTGATGAAGG - Intronic
1107068792 13:36246698-36246720 CTAGCTAAGATCACTGATGAAGG + Intronic
1110162631 13:72397586-72397608 CTGGACAAAGACACTGCTGCAGG - Intergenic
1110282477 13:73711263-73711285 CTAGCTAAGATCACTGATGAAGG + Intronic
1110316414 13:74113239-74113261 CTAGCTAAAATCACTGATGAAGG + Intronic
1110746345 13:79057776-79057798 CTGGCTAAGATCATTGATGAAGG + Intergenic
1112208725 13:97351520-97351542 CTAGCTAAGATCACTGATGAAGG - Intronic
1114977329 14:28118340-28118362 CTAGCTAAAATCACTGATGAAGG + Intergenic
1115136356 14:30113341-30113363 CTAGCTACTAACACTGATGAAGG + Intronic
1115154719 14:30324995-30325017 CTAGCTAAAATCACTGATGAAGG + Intergenic
1117201734 14:53396854-53396876 CTGGCTAAGATAACTGATGAAGG + Intergenic
1117391855 14:55270299-55270321 CTGGCTAAAATCAAAGTTGCTGG + Intergenic
1119017187 14:71070958-71070980 CTAGCTAAGATCACTGATGAAGG - Intronic
1121930346 14:97966484-97966506 CTGGGTAAAGACATTGATGAGGG + Intronic
1124093392 15:26626853-26626875 CCCGCTAAAATCACTGATGAAGG + Intronic
1128376045 15:67076767-67076789 CAGGCTCAAGACACTGATGCAGG - Intronic
1129129955 15:73484727-73484749 CTAGGTAAAGACACTCATGCTGG - Intronic
1130129743 15:81129995-81130017 CTGGCTAAGATCATTGATGTAGG - Intronic
1131271160 15:90948437-90948459 CTTGCTAACACCACTGGTGCTGG - Intronic
1131899203 15:97069255-97069277 GTGGCTAAAAACATGGATGTTGG + Intergenic
1131986031 15:98043625-98043647 CTGGGTAAACTCAGTGATGCCGG + Intergenic
1137369210 16:47889090-47889112 CTGTCTGAAAACTCTGATGAAGG + Intergenic
1138288027 16:55824705-55824727 CTGGCTAAAAAGGCAGAGGCAGG - Intronic
1143638004 17:8177378-8177400 CTGGCTAAAAGCACTGAGATGGG - Intergenic
1146724143 17:35143845-35143867 ATGGGCAAAATCACTGATGCAGG - Intergenic
1146838234 17:36129754-36129776 CTGGCTAAGATCATTGATGAAGG + Intergenic
1148803791 17:50252773-50252795 CTAGCTAAGATCACTGATGAAGG - Intergenic
1149827341 17:59841392-59841414 CTGATTATAAACAATGATGCTGG - Intronic
1153783998 18:8518111-8518133 CTTGCTGAAAACAGTGAAGCAGG - Intergenic
1153976984 18:10277925-10277947 CTGGCTAAGGTCACTGATGAAGG - Intergenic
1154341548 18:13506599-13506621 CTAGCTAAGATCACTGATGAAGG + Intronic
1154341703 18:13508337-13508359 CTAGCTAAGATCACTGATGAAGG + Intronic
1156880764 18:42075927-42075949 CTAGCTAAGATCACTGATGAAGG - Intronic
1156880768 18:42076013-42076035 CTAGCTAAGATCACTGATGAAGG - Intronic
1158533607 18:58286071-58286093 CTGTCTATAAACACTGACACTGG - Intronic
1159121151 18:64172988-64173010 CTAGCTAAGATCACTGATGAAGG - Intergenic
1159695004 18:71546055-71546077 CTAGCTAAAAGCACTGATGAAGG - Intergenic
1165599363 19:37040149-37040171 CTGGCTAAGATCATTGATGAAGG - Intronic
925118770 2:1401702-1401724 CTGGCAGAAGACACTGAGGCAGG - Intronic
926979190 2:18549165-18549187 CTAGCTAAGAACATTGATGAAGG + Intergenic
928220086 2:29396210-29396232 CTGGATAATAACGCTGTTGCAGG + Intronic
928229594 2:29485912-29485934 CTGGCTGCAAGCACTGATTCTGG + Intronic
928287995 2:30010072-30010094 CTGGCTTCAACCACTGCTGCAGG - Intergenic
928818947 2:35336991-35337013 CTAACTAAAATCACTGATGAAGG + Intergenic
929375071 2:41275680-41275702 CTAGCTAAGACCACTGATGAAGG - Intergenic
929529710 2:42741030-42741052 CTAGCTAAGATCACTGATGAAGG - Intronic
929672902 2:43892163-43892185 CTAGCTAAGACCACTGATGAAGG + Intronic
929754137 2:44749835-44749857 TTAGCTAAAAAGAATGATGCAGG + Intronic
929757821 2:44782287-44782309 CTAGCTAAGATCACTGATGAAGG + Intergenic
932862460 2:75308584-75308606 CTAGCTAAGATCACTGATGAAGG + Intergenic
933630220 2:84647327-84647349 CTAGCTAAGAACACTGATGAAGG + Intronic
933814711 2:86056495-86056517 CTAGCTAAGATCACTGATGAAGG + Intronic
933873637 2:86595968-86595990 CTAGCTAAGATCACTGATGAAGG + Intronic
934061700 2:88300405-88300427 CTAGCTAAGATCACTGATGAAGG + Intergenic
935608278 2:104992975-104992997 CTAGCTAAGATCACTGATGAAGG + Intergenic
936079908 2:109425336-109425358 CTAGCTAAAATCACTGATGAAGG + Intronic
936920231 2:117681176-117681198 CTAGCTAAGATCACTGATGAAGG + Intergenic
937116497 2:119408630-119408652 CTGCCTAAAAAGTTTGATGCGGG + Intergenic
939779282 2:146424395-146424417 CTGTCTAAAAGCAATGATGGAGG + Intergenic
939931300 2:148236884-148236906 CTAGCTAAAATCATTGATGAAGG - Intronic
940456750 2:153911441-153911463 CTAGCTAAAAACACTGCGACAGG - Intronic
940686746 2:156860421-156860443 CTGGCTAAAAATACGGATTCTGG - Intergenic
941801819 2:169668084-169668106 CTGGCTAAAATCATTGATGAAGG - Intronic
942521700 2:176810857-176810879 CTAGGAAAAAACACTCATGCTGG - Intergenic
946264867 2:218531061-218531083 CTAGCTAAGATCACTGATGAAGG + Intronic
947020682 2:225672240-225672262 CTAGCTAAAATAACTGATGAAGG - Intergenic
1169120706 20:3093937-3093959 AAGGCTTAAAACAGTGATGCTGG - Intergenic
1170252304 20:14297744-14297766 CTAGCTAAGACCACTGATGAAGG + Intronic
1170397179 20:15939164-15939186 CTAGCTAAAATCACTGATCAAGG + Intronic
1170816722 20:19720474-19720496 CTCCCTAAAAACACTGAGCCTGG - Intronic
1173882670 20:46428977-46428999 CTAGCTAAGATCACTGATGAAGG + Intronic
1174673235 20:52328111-52328133 CTAGCTAAAATCATTGATGAAGG + Intergenic
1174834506 20:53843630-53843652 CTAGCTAAGATCACTGATGGAGG + Intergenic
1175451699 20:59074610-59074632 CTGACTCATAACACTGACGCTGG + Intergenic
1177494969 21:21876884-21876906 TTGGATAAAAACACAGAAGCGGG - Intergenic
1177643179 21:23870148-23870170 GTGGCCAAGAACGCTGATGCAGG + Intergenic
1179504415 21:41831274-41831296 CTGGCCCAAAACGCTGAGGCAGG - Intronic
1180848819 22:19000197-19000219 CTAGCTAAGATCACTGATGAAGG - Intergenic
1180932531 22:19602642-19602664 CTGGCTAAGATCACTGATGAAGG - Intergenic
1181664014 22:24378099-24378121 CTAGCTAAGATCACTGATGAAGG - Intronic
1182731179 22:32495960-32495982 GTAGCTAAAATCACTGATGAAGG + Intronic
950162578 3:10771473-10771495 CTGGATAAGAAGACTGAAGCTGG - Intergenic
950808338 3:15627672-15627694 TAGGCTAGAAACACTGACGCTGG - Intronic
951042913 3:18007853-18007875 CTAGCTAAAATCATTGATGAAGG - Intronic
951506927 3:23457447-23457469 CTAGCTAAGATCACTGATGAAGG - Intronic
953916958 3:46926490-46926512 CTGCCTGAAAAGACTGAGGCAGG - Intronic
954940121 3:54364066-54364088 CTGGCTAAAAACCCACCTGCAGG - Intronic
954966625 3:54617200-54617222 CTAGAAAAACACACTGATGCAGG - Intronic
955335415 3:58081458-58081480 ATGGTTAAAAACACTGATATTGG + Intronic
955679440 3:61485311-61485333 CTAGCTAAGATCACTGATGGAGG - Intergenic
960599478 3:119441671-119441693 CTAGCTAAGATCACTGATGAAGG + Intronic
961733131 3:128982197-128982219 CTAGCTAAGATCACTGATGAAGG - Intronic
963284913 3:143424780-143424802 GTGGTTAAAAACACAGGTGCTGG + Intronic
963574457 3:147042522-147042544 CTGACTAAAAACTCTGGTGTAGG - Intergenic
963860009 3:150299450-150299472 CTGGATAAAACCACTGCTTCTGG + Intergenic
964599170 3:158476298-158476320 CTAGCTAAGATCACTGATGAAGG + Intronic
964870440 3:161308112-161308134 CTAGCTAAAATCACTGATGAAGG + Intergenic
965575104 3:170210044-170210066 CTGGTTAAAACCACTGTTGGTGG + Intergenic
965886660 3:173454486-173454508 CTAGCTAAGATCACTGATGAAGG - Intronic
965922742 3:173938821-173938843 CTGTCATAAATCACTGATGCTGG - Intronic
966118301 3:176491477-176491499 CTGGCTACATAAACTGTTGCAGG + Intergenic
966485515 3:180465038-180465060 CTGGCTAAAAATAATTAAGCTGG - Intergenic
967917647 3:194590675-194590697 CTGGCTAAAAACACTGATGCTGG + Intronic
969721841 4:8896374-8896396 CTGGCCACCAACACTGACGCAGG + Intergenic
970578845 4:17454772-17454794 CTAGCTAAGATCACTGATGAAGG + Intergenic
971080995 4:23210987-23211009 ATGGCAAAAAACACTGATATAGG - Intergenic
972284204 4:37632468-37632490 GTGGTTAAAAAAACTGATGTAGG - Intronic
973692730 4:53454912-53454934 CTAGCTAAAATCACTGATGAAGG - Intronic
975967126 4:79986739-79986761 CTGGCAAAACACTCTGATGGGGG - Intronic
976397979 4:84577890-84577912 GCGGCAAAAAACACTGATTCTGG - Intergenic
977356007 4:95947655-95947677 CTAGCTAAGATCACTGATGAAGG - Intergenic
977539384 4:98298266-98298288 CTAGCTAAAATCATTGATGAAGG + Intronic
978134374 4:105239391-105239413 CTAGCTAAGATCACTGATGAAGG - Intronic
979625946 4:122845525-122845547 CTAGCTAAGATCACTGATGAAGG - Intronic
980179450 4:129386300-129386322 CTGGATAAAGAAACTGTTGCTGG - Intergenic
981144296 4:141307219-141307241 CTGGAAAATAACACTGATGAGGG - Intergenic
981232538 4:142374252-142374274 CTGGATATAAACCCTGATTCAGG + Intronic
982148147 4:152421057-152421079 CTAGCTAAGATCACTGATGAAGG - Intronic
984121340 4:175748854-175748876 CTAGCTAAGAACATTGATGGAGG - Intronic
984545089 4:181091926-181091948 CTAGCTAAGAGCACTGATGAAGG - Intergenic
985481689 5:115608-115630 CTGGCTAAGACCATTGATGAAGG - Intergenic
985700001 5:1365326-1365348 CTGGCTGAAAACACAGCTGCAGG + Intergenic
985732737 5:1558757-1558779 CTGGCTAAGATCACTGATGAAGG - Intergenic
986285968 5:6359245-6359267 ATGGTTAAAAACACTGAGGCTGG + Intergenic
986928500 5:12789745-12789767 CTAGTTAACATCACTGATGCAGG - Intergenic
987726705 5:21709981-21710003 CTGGCTAAGATCACTGATGAAGG + Intergenic
990000928 5:50891815-50891837 CTGGGTAAATACACAGAAGCAGG - Intergenic
990523077 5:56598598-56598620 CTGGCTAAGATCATTGATGAAGG - Intronic
990697400 5:58436001-58436023 CTAGCTAAGATGACTGATGCAGG - Intergenic
990734397 5:58844331-58844353 CTGGCTAAAGACACAGACTCAGG + Intronic
991936185 5:71803085-71803107 CTGGCTAAGATCATTGATGAAGG - Intergenic
992074492 5:73178139-73178161 CTGGCTAAGATCATTGATGGAGG - Intergenic
992074602 5:73179616-73179638 CTGGCTAAGATCATTGATGGAGG + Intergenic
992127889 5:73661121-73661143 CTGGCTAAGATCATTGATGAAGG - Intronic
992538217 5:77733737-77733759 CTAGCTAAGATCACTGATGAAGG + Intronic
992836052 5:80642469-80642491 CTGGCTAAGATCATTGATGAAGG + Intronic
994194709 5:96909585-96909607 CTGGCTTAAAATACTGAAGAAGG - Exonic
994870247 5:105338829-105338851 CTTGCTAAAATCACTGACGAAGG - Intergenic
996586672 5:125096018-125096040 CTAGCTAAAATCATTGATGAAGG + Intergenic
997147320 5:131450761-131450783 CTGGCTGACAAAACTGATTCAGG + Intronic
997273548 5:132563225-132563247 CTGGACAGAAACATTGATGCAGG + Intronic
998371511 5:141664926-141664948 CTGGGTAACAAAACTGATGCAGG + Exonic
999719980 5:154392338-154392360 CTTACTGAAAACACTGATGTGGG - Intronic
1000312557 5:160059230-160059252 CTAGCTAAGATCACTGATGAAGG - Intronic
1000739689 5:164952605-164952627 GTGGCTAAAATCACTGAAGCAGG + Intergenic
1000850463 5:166333662-166333684 CTGGGTAAAAATACTGTTGATGG - Intergenic
1002881779 6:1258923-1258945 CTAGCTAAGAGCACTGATGAAGG + Intergenic
1003187688 6:3847318-3847340 CTAGCTAAGAGCACTGATGACGG - Intergenic
1004399068 6:15271697-15271719 ATGTTTAAAAACAGTGATGCGGG + Intronic
1005569336 6:27129740-27129762 TTGGCTAATACTACTGATGCCGG - Intronic
1005689935 6:28294372-28294394 CTAGCTAAAATCACTAATGAAGG + Intronic
1005727792 6:28666452-28666474 CTGGTTAAAACTAATGATGCAGG - Intergenic
1007090753 6:39183390-39183412 CTGGGTAATAACACTGTTGTGGG + Intergenic
1007379732 6:41480508-41480530 CTGGCTAAGATCACTGATGAAGG + Intergenic
1007685058 6:43661760-43661782 CTGGCTAAGATCACTGATTAAGG - Intronic
1008125868 6:47667624-47667646 CTGGCTAAGATCACAGATGAAGG + Intronic
1008492592 6:52101835-52101857 CTGTCTAAAAACTCAGATACTGG - Intergenic
1008916930 6:56798122-56798144 CTGGCTAAAATCATTGATGAAGG + Intronic
1009387348 6:63101392-63101414 CTAGCTAAAATCATTGATGAAGG - Intergenic
1010724545 6:79318379-79318401 CTGGCTAAGATCATTGATGAAGG - Intergenic
1010738567 6:79471067-79471089 CAAGCAAAAAACACTTATGCTGG + Intergenic
1011554262 6:88558137-88558159 GTGGGTAAAAATACTAATGCTGG - Intergenic
1012644543 6:101662518-101662540 CTGGTAAAAAACACTTATGAAGG - Intronic
1012666104 6:101972256-101972278 CAGACAAAAAACAATGATGCTGG - Intronic
1013030919 6:106331942-106331964 CTAGCTAAAATCATTGATGAAGG + Intergenic
1014130403 6:117824972-117824994 CTAGCTAAGAACGCTGATGATGG - Intergenic
1014319649 6:119911117-119911139 CTGGCTAAGATCATTGATGAAGG + Intergenic
1014741447 6:125152182-125152204 CTGGCTAAGATCATTGATGAAGG + Intronic
1015851358 6:137575869-137575891 TTGGCTAAAAAGGGTGATGCAGG - Intergenic
1018909086 6:168091628-168091650 CTTGCTAGATACACAGATGCTGG - Intergenic
1021411855 7:20337945-20337967 ATGGCCAAGGACACTGATGCAGG + Intronic
1024824698 7:53378172-53378194 ATGGCTAATAACACAGGTGCCGG - Intergenic
1025050522 7:55730353-55730375 GTGACGTAAAACACTGATGCTGG - Intergenic
1026414791 7:70168246-70168268 CTGTCTACAAACATTTATGCAGG + Intronic
1027944901 7:84732335-84732357 CTAGCTAAGACCACTGATGGAGG - Intergenic
1028267333 7:88742383-88742405 CTGGCATGAAACACAGATGCTGG + Intergenic
1028300134 7:89188941-89188963 CTAGCTAAGATCACTGATGAAGG + Intronic
1029378027 7:100193495-100193517 CTAGCTAAGATCACTGATGAAGG - Intronic
1030136827 7:106260217-106260239 CTAGCTAAGATCATTGATGCAGG - Intronic
1032374862 7:131403131-131403153 CTTGCTAAGATCACTGATGAAGG - Intronic
1033119360 7:138653262-138653284 CTAGCTAAGATCACTGGTGCAGG + Intronic
1033228608 7:139579873-139579895 CTTGCTAAGAATACTGATTCCGG - Intronic
1033241683 7:139685131-139685153 CTGGCTAAGATCATTGATGAAGG + Intronic
1033719555 7:144043784-144043806 ATATGTAAAAACACTGATGCTGG + Intergenic
1034743356 7:153498864-153498886 CTAGCTACAATCACTGATGAAGG + Intergenic
1035066910 7:156112283-156112305 CTAGCTAAGATCACTGATGAAGG - Intergenic
1035539491 8:421703-421725 CTGGCTCTAGTCACTGATGCAGG - Intronic
1036023938 8:4881886-4881908 CAGGGGAAAAACATTGATGCTGG + Intronic
1036088844 8:5642720-5642742 CTAGCTAAGATCACTGATGAAGG + Intergenic
1036388260 8:8301181-8301203 CTAGCTAAGATCACTGATGAAGG - Intergenic
1036479706 8:9128424-9128446 CTGTCTACAAAAACTGTTGCTGG - Intergenic
1037014623 8:13886799-13886821 GTAGCTCAAAACACTGATACTGG - Intergenic
1039405345 8:37307920-37307942 CTGGCTAAAAGCACAGACTCTGG + Intergenic
1039652677 8:39359292-39359314 CTAGCTAAGATCATTGATGCTGG + Intergenic
1041011196 8:53545557-53545579 CTGTCTAAAAGCACTGAGACAGG + Intergenic
1041158262 8:55010363-55010385 GAGGCTTAAAACACTGGTGCAGG + Intergenic
1041540298 8:58977150-58977172 CTAGCTAAGATCACTGATGAAGG - Intronic
1041586475 8:59526163-59526185 CTAGCTAAGATCACTGATGAAGG + Intergenic
1044181932 8:89206918-89206940 CTTGAAAAAAACACTGTTGCCGG + Intergenic
1048172772 8:132123370-132123392 CTAGCAAAAACCACTGCTGCTGG - Exonic
1048824238 8:138408284-138408306 CTAGCTGAAATCACTGATGAAGG - Intronic
1049145305 8:140996386-140996408 CTAGCTAAGATCACTGATGAAGG + Intronic
1049227496 8:141463724-141463746 CTAGCTAAGATCACTGATGAAGG + Intergenic
1050330258 9:4538705-4538727 CCGGCTCAAAGCACAGATGCTGG - Intronic
1051305341 9:15702696-15702718 CTAGCTAAAATCCCCGATGCAGG - Intronic
1051521639 9:17995803-17995825 CTGGATAAAAATGCTGGTGCTGG + Intergenic
1051538138 9:18182871-18182893 CTGCCTCTAAACACTGAAGCAGG + Intergenic
1051601652 9:18880888-18880910 CTGGCTAAGATCACTGATGATGG - Intronic
1051753665 9:20371274-20371296 CTAGCTAACAACATTGATGAAGG + Intronic
1052007827 9:23371473-23371495 CAGGCTAATAACACTGATGACGG + Intergenic
1052591867 9:30507454-30507476 CTGGCTAAGATCATTGATGAAGG - Intergenic
1053217709 9:36286275-36286297 CTGGCTAAGATCACTGACGAAGG - Intronic
1053250420 9:36569663-36569685 TTGGCTAAGATCATTGATGCAGG + Intergenic
1054839464 9:69720542-69720564 CTAGCTAAGATCACTGATGAAGG + Intronic
1054895906 9:70310759-70310781 CTAGCTAAGATCACTGATGAAGG - Intronic
1056806179 9:89730785-89730807 CTGGGTAAACACACTCAAGCTGG - Intergenic
1056979295 9:91293727-91293749 CTAGCTAAGATCACTGATGAAGG + Intronic
1057078063 9:92150590-92150612 CTGATTATAAACAATGATGCTGG - Intergenic
1057543264 9:95996419-95996441 CTAGCTAAGATCACTGATGAAGG + Intronic
1057791075 9:98125490-98125512 GTGGCTAAGAACACAGAGGCTGG - Intronic
1058429306 9:104904073-104904095 GTGGCCAAAAACACTGAGGATGG + Intronic
1060210954 9:121710103-121710125 GTGGTTAAAAACACTGATGTGGG - Intronic
1186006668 X:5079733-5079755 CTGGTTAATAACACTGTTGATGG - Intergenic
1186304043 X:8234764-8234786 CTAGCTAAAATCACTCATGAAGG - Intergenic
1190171921 X:48118089-48118111 CTAGCTAAAATCACTGATGAAGG - Intergenic
1190180660 X:48189173-48189195 CTAGCTAAGATCACTGATGAAGG + Intronic
1190196632 X:48325137-48325159 CTAGCTAAGATCACTGATGAAGG - Intergenic
1190199574 X:48349030-48349052 CTAGCTAAGATCACTGATGAAGG + Intronic
1190658222 X:52631346-52631368 CTAGCTAAGATCACTGATGAAGG - Intergenic
1190663358 X:52675507-52675529 CTAGCTAAGATCACTGATGAAGG - Intronic
1190676065 X:52782975-52782997 CTAGCTAAGATCACTGATGAAGG + Intronic
1194066885 X:89271665-89271687 CTGGCTAGAAGCACTGTAGCAGG - Intergenic
1197111365 X:122778892-122778914 CTGGCAAGTGACACTGATGCTGG + Intergenic
1197477237 X:126940531-126940553 CTGGCTATAGCCACTGATGAGGG - Intergenic
1198735321 X:139778421-139778443 CTAGCTAACAACACTAAGGCAGG + Intronic
1200721050 Y:6605824-6605846 CTGGCTAGAAGCACTGTAGCAGG - Intergenic