ID: 967917986

View in Genome Browser
Species Human (GRCh38)
Location 3:194592995-194593017
Sequence CTTCCAGGAGGGACTTCCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967917986_967917990 16 Left 967917986 3:194592995-194593017 CCATAGGAAGTCCCTCCTGGAAG 0: 1
1: 0
2: 2
3: 18
4: 163
Right 967917990 3:194593034-194593056 TCCATACCTGCTCCGAGTTTAGG 0: 1
1: 0
2: 0
3: 2
4: 73
967917986_967917992 17 Left 967917986 3:194592995-194593017 CCATAGGAAGTCCCTCCTGGAAG 0: 1
1: 0
2: 2
3: 18
4: 163
Right 967917992 3:194593035-194593057 CCATACCTGCTCCGAGTTTAGGG 0: 1
1: 0
2: 0
3: 6
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967917986 Original CRISPR CTTCCAGGAGGGACTTCCTA TGG (reversed) Intronic
900241563 1:1619838-1619860 CTTCCATGAGGGACAGCCTCTGG + Intronic
901848961 1:12003159-12003181 CTTCCTGGGGTGAGTTCCTAGGG + Intronic
902291250 1:15436756-15436778 CTATCAGGAAGGAATTCCTAAGG + Intergenic
902526095 1:17058502-17058524 AATCAAGGAGGGACTTCCTAAGG - Intergenic
904128445 1:28259131-28259153 GTTCCTGGAGGGACTGGCTAGGG - Intergenic
904583686 1:31566751-31566773 CTTCCAGGAGGGGCCTCCCTGGG - Intergenic
910544152 1:88395323-88395345 CTACCAGCAGGGACCTCCAAAGG + Intergenic
915461456 1:156072846-156072868 ATTCCAAGAAGGACTTCCCACGG - Exonic
916034226 1:160906560-160906582 CCTCCAGGAGGGACTTAAAAAGG + Intergenic
917491203 1:175500179-175500201 CTTCCAGGAGGGTTTTTTTAAGG + Intronic
920350511 1:205335124-205335146 TTTCCAGAATGGACTTCCAAGGG + Intergenic
920388133 1:205582162-205582184 CTTCCAGGAGAGACCTGCGAAGG + Intronic
922075052 1:222235409-222235431 GTTCCTGGAGGAACTTCCCAGGG - Intergenic
922554994 1:226526245-226526267 TTCCAAGGAGGAACTTCCTAAGG + Intergenic
923180054 1:231508890-231508912 CTTCCATGATGGTCTTCCCAGGG - Intergenic
1063548240 10:7002632-7002654 CTTCAAGGAGGGACTTGCTGTGG + Intergenic
1069942616 10:71965447-71965469 CTTCCTCCAGGGACTTCCAAGGG + Intronic
1070115127 10:73521273-73521295 CTTCCTTGAGGGACTTCCTAAGG - Intronic
1070801608 10:79247322-79247344 CTTCCCCGAGGGACTCACTATGG - Intronic
1072800805 10:98391067-98391089 CTTCCAGGAGTGGCTTCCTGAGG - Exonic
1073058242 10:100715649-100715671 CGTCCGGGAGGGACTGCCCAGGG + Intergenic
1074420718 10:113306573-113306595 TTTCCAGGTGAGACCTCCTAGGG - Intergenic
1076504267 10:130961742-130961764 CTTCCTTGGGGGACTGCCTAAGG - Intergenic
1077564516 11:3288864-3288886 GTTCCAGGAAGGACTTACTGAGG - Intergenic
1077570405 11:3334681-3334703 GTTCCAGGAAGGACTTACTGAGG - Intergenic
1081398994 11:42620707-42620729 CTACCAGCAGAGATTTCCTAGGG - Intergenic
1084590123 11:70085556-70085578 TTTCCAGGAGAGGCATCCTAGGG + Intronic
1084963827 11:72733105-72733127 CCTCCAGGAAGGCCTTCCTCTGG - Intronic
1088553127 11:111035090-111035112 CTTCCAGGAGGACTTTCCTGTGG + Intergenic
1088992219 11:114963514-114963536 TCTGCAGCAGGGACTTCCTAAGG - Intergenic
1089812283 11:121141973-121141995 CTTCCAGGAAGCTCTCCCTAAGG - Intronic
1092088663 12:5786233-5786255 CTTCCAGGACTAACTTCCTATGG - Intronic
1095139793 12:38647482-38647504 CTTCAAGGAAGGACTTTATAAGG + Intronic
1096185881 12:49580330-49580352 CTGCCAGGAGGCCCTTCCCATGG - Intronic
1096620087 12:52858931-52858953 CTACAAGGAGGGCATTCCTAAGG + Intergenic
1097937845 12:65273359-65273381 CCTCCAGGATGGGCCTCCTATGG + Intergenic
1098152331 12:67559691-67559713 CTTTCAGGAGGGCCTAGCTAAGG - Intergenic
1100574147 12:95873754-95873776 GTTCCAGGAGGGGCTTCCCATGG - Intronic
1100616431 12:96235057-96235079 CTTCCAGAAGACGCTTCCTATGG + Intronic
1101002156 12:100367506-100367528 ATTCCAGGAGAGAATGCCTAAGG - Intronic
1101822036 12:108191719-108191741 CTTCCAGGGGGCTCTTCCTCTGG + Intronic
1102671464 12:114622964-114622986 CTTACTGGAGGGACTTCTTCTGG - Intergenic
1103010579 12:117455481-117455503 CTTCCTGGAGGGTCTTTCTCTGG + Exonic
1104353403 12:128064297-128064319 CATCCAGGAGGGACTGCATCGGG + Intergenic
1105052082 12:133063744-133063766 CTTCAAGGAGGGACTTACCCAGG - Intergenic
1108521160 13:51248132-51248154 CTTCCAGGAGAGATGTCCTTTGG - Intronic
1110573615 13:77031966-77031988 GTTCCAAGAGGGAGTTGCTAAGG - Intergenic
1113368906 13:109705150-109705172 CTTCCACCAGGTGCTTCCTATGG - Intergenic
1115732095 14:36281658-36281680 CTTCCAAGATGGACTTACTTGGG + Intergenic
1121553747 14:94820863-94820885 CTTCCAGGAGGGTCAGCCTCAGG + Intergenic
1122150858 14:99725475-99725497 GCTCCAGGAGGGACTTACTTGGG - Exonic
1122904036 14:104793843-104793865 CTTCCAGATGGGCCTTCCTGAGG + Exonic
1123142709 14:106096530-106096552 CTTGAAGGAGGGGCTTCCTGAGG - Intergenic
1123964499 15:25441383-25441405 CTTACAGGTGTGACTTCCTCTGG - Intergenic
1126067776 15:44839074-44839096 CATCCTGGAGGGAATTCCTGTGG - Intergenic
1126092051 15:45061502-45061524 CATCCTGGAGGGAATTCCTGTGG + Intronic
1132088182 15:98924800-98924822 CTTCCAGAAGGGTCATGCTAAGG + Intronic
1132460888 16:53998-54020 GTTCCAGGAGGGTCTGGCTATGG + Exonic
1134210543 16:12272754-12272776 CTTCCAAGAGGGGCTTCTGAAGG - Intronic
1134555892 16:15164431-15164453 CTTCTAGGAGCCACTACCTAGGG - Intergenic
1134916475 16:18076165-18076187 CTTCTAGGAGCCACTACCTAGGG - Intergenic
1135965493 16:27031687-27031709 CTTCAGGAAGGGACTTCCTGGGG - Intergenic
1136494199 16:30631928-30631950 CTTCCACCAGGGACTTCCTCTGG - Intergenic
1137718408 16:50612893-50612915 CTTCTGGGAGGGACTGCCCATGG + Intronic
1141749512 16:85948692-85948714 CTCCCAGGAGGTAGGTCCTATGG - Intergenic
1141766839 16:86064433-86064455 CTTCCAGGTGGGACTGCCTCTGG - Intergenic
1147314845 17:39614886-39614908 TTTTGAGGAGGGACTTCCTGTGG - Intergenic
1151853104 17:76702906-76702928 CTTTCAGGAAGTTCTTCCTATGG - Intronic
1151891073 17:76950544-76950566 CCACCAGCAGGGACTTCCTTTGG - Intergenic
1152580673 17:81164373-81164395 CTACCAGGAGGGGCTGCCCAAGG - Intronic
1153129094 18:1834272-1834294 CTTCCAGGAGGCATTTCCAAAGG - Intergenic
1156362838 18:36399557-36399579 CCTCCAGGAGCCACTTCCTCAGG - Intronic
1162948329 19:14056786-14056808 GTTCCCGGAGAGACTTCCTCTGG + Exonic
1165123080 19:33575278-33575300 GTTCCAGGAGGGAAATCCTCAGG + Intergenic
1165779139 19:38422137-38422159 ATTCCTGGTGGGACTTCCTGTGG + Exonic
1166223140 19:41378275-41378297 ACTCCAGGAGGGGTTTCCTAGGG - Exonic
1166965758 19:46528611-46528633 CTTCCAGAGGGGTGTTCCTAAGG + Intronic
925150828 2:1613656-1613678 CTTCCAGGAGGGAGTCCTCAAGG - Intergenic
927793180 2:26026870-26026892 CTTCCTGCAGGGACTTCATGAGG - Intergenic
929560118 2:42951256-42951278 CTTCCAGCAGTGACTTCCCGTGG + Intergenic
929867666 2:45732023-45732045 CTTACAGGAAAGACTTTCTAAGG - Intronic
930318113 2:49821893-49821915 CTCCCACCAGGGACTTTCTAGGG - Intergenic
932059696 2:68483342-68483364 GAGCCAGGAGGGACTTCTTATGG - Intronic
932417840 2:71584394-71584416 CTTCCTGAAGGGGCTTCCAAAGG + Intronic
933649779 2:84841227-84841249 CTTCCAGGAGGGAAGTGGTACGG - Intronic
934049855 2:88200918-88200940 CTTCCAGGAGGCATCTCCTCCGG - Intergenic
934619928 2:95797711-95797733 CTTCCTGGAGGAACCTCCTGGGG + Intergenic
934640960 2:96026846-96026868 CTTCCTGGAGGAACCTCCTGGGG - Exonic
935742267 2:106160026-106160048 CTTTCCTGAGGCACTTCCTATGG - Intronic
936045758 2:109186649-109186671 TTTCCCGCAGGGTCTTCCTAGGG - Intronic
936798932 2:116242863-116242885 CTTCCAGGCAGGCCTTTCTAAGG + Intergenic
937979400 2:127605837-127605859 CTTCTAGGAAGGAGTTCCTGAGG + Exonic
937986065 2:127638651-127638673 ATTCCAGGAAGGCCTTCCGAAGG + Exonic
940396791 2:153198982-153199004 CTTCCAGATGGGACACCCTATGG + Intergenic
941095400 2:161235463-161235485 CATCCAGGGGGGATTTCCTTCGG + Exonic
945540750 2:211083100-211083122 CTTCCAGGAGAGAATTCTTCAGG + Intergenic
945701778 2:213179525-213179547 CTTCCAAGAAGGCCTTCATATGG + Intergenic
1170285254 20:14701007-14701029 CTTCTATGAGGGAATTCCTGTGG + Intronic
1172122200 20:32605003-32605025 CCTCCAGGAAGGACCTCCGAAGG + Intronic
1172215142 20:33230400-33230422 CTTCCTGTAGGGACCTCCTTGGG + Intergenic
1173249371 20:41356643-41356665 CCCCAAGGAGGGGCTTCCTATGG + Intronic
1175051369 20:56158420-56158442 ATTCATGGAGGCACTTCCTAGGG - Intergenic
1176025691 20:62984407-62984429 CTGGCAGGAGGGGCCTCCTATGG - Intergenic
1176516087 21:7784606-7784628 CATCCAGGAATGACTTCCTCTGG - Intergenic
1178650115 21:34414618-34414640 CATCCAGGAATGACTTCCTCTGG - Intergenic
1179658904 21:42862443-42862465 CTTCCATGAGGGACTTGATTCGG - Intronic
1180157383 21:45984106-45984128 CTTCCAGGAGGGCCGGCCTCAGG + Intronic
1180244660 21:46539032-46539054 CTCCCAGGAGGAGCTCCCTATGG + Intronic
1180785179 22:18543243-18543265 CACCCAGGAGCGACTTCCCATGG + Intergenic
1181128760 22:20717284-20717306 CACCCAGGAGCGACTTCCCATGG + Intronic
1181242082 22:21482596-21482618 CACCCAGGAGCGACTTCCCATGG + Intergenic
1181577545 22:23804965-23804987 CTCTCAGAAGGGATTTCCTAAGG + Intronic
1182205599 22:28621951-28621973 CTTCCAGTAGAGACTGGCTAGGG + Intronic
1182596229 22:31422872-31422894 CTTACAGATGGGACTTCATATGG + Intronic
1183406836 22:37634285-37634307 CTTAAATGAGGGACTTCCCAGGG - Intergenic
1183949771 22:41346285-41346307 GTTCCAGGGCTGACTTCCTATGG - Intronic
1184932402 22:47691041-47691063 CTCCCAGGGTGGACATCCTATGG - Intergenic
949503336 3:4703248-4703270 CTTGAATGAGGGACTTCCCAGGG - Intronic
950492833 3:13316590-13316612 CATCCAGAAGGGACTCCCCAGGG - Exonic
950810653 3:15647125-15647147 CCTTCCAGAGGGACTTCCTAGGG - Intergenic
956325299 3:68045517-68045539 CTTACAGGAGGAGCTTCCCAAGG - Intronic
956642414 3:71427575-71427597 CTTCCAGGAGGGACATATAAAGG + Intronic
956872349 3:73430535-73430557 CTTTGAGGAGGGTCTTCCAATGG - Intronic
957236090 3:77593683-77593705 CTTAAAGGAGGGACTTCATTTGG + Intronic
961356925 3:126345163-126345185 AGTCCTGGAGGGATTTCCTAAGG - Intronic
961578259 3:127856283-127856305 ATTCCAGAAGAGACTTCCTTTGG + Intergenic
964949231 3:162267286-162267308 CTTCCATGAGGGACGTGGTATGG + Intergenic
965310493 3:167121432-167121454 CTTCCATTAGGGACTTCCCTGGG + Intergenic
966035074 3:175401968-175401990 CTTCATGGAGTGACTTCCTAAGG + Intronic
967917986 3:194592995-194593017 CTTCCAGGAGGGACTTCCTATGG - Intronic
968542698 4:1175915-1175937 CAGCCAGGAGGAACTTCCTTTGG + Intronic
970502299 4:16690443-16690465 CTTCCTGCAGGGTCTTCCTCCGG - Intronic
975530725 4:75396627-75396649 CTCTCAGGAGGGCCTTCCCAGGG - Intergenic
975668902 4:76760518-76760540 ATTCCAGGAGAAACTTTCTAGGG + Intronic
975851845 4:78580649-78580671 CTCCCAGGAGGTAATTCCTGAGG - Intronic
982882139 4:160732477-160732499 CTTCCTGGAGGGACCTTCTTGGG + Intergenic
984279196 4:177647847-177647869 TTTCCAGTAGGGTCTTGCTATGG - Intergenic
986007193 5:3677914-3677936 CTTCCAGGAGGGCCCTGCTGAGG - Intergenic
988866292 5:35338832-35338854 CATGGAGGAGGGACTGCCTAGGG - Intergenic
990594403 5:57298755-57298777 CCTCCAGCAGGGACTTTTTAAGG - Intergenic
992018990 5:72603918-72603940 CTTCCACGAGGGGCATGCTATGG - Intergenic
992065401 5:73103145-73103167 CTTCCAGAAGGAACTGCCTAAGG + Intergenic
992844887 5:80736513-80736535 CTTGCAGGAAGGCCTTTCTAAGG - Intronic
996367148 5:122715268-122715290 CTTCCAGAAGAGAGTTCCTATGG - Intergenic
997345921 5:133191982-133192004 CTTCCAGGAGCCTCTTTCTAAGG - Intergenic
997390436 5:133510729-133510751 CTTCCAGAAAGGACTCCCTGGGG - Intronic
1000447076 5:161335227-161335249 CTTACAGGATGAACTTACTAAGG - Intronic
1001511402 5:172325331-172325353 CTTCTAAGAGGGACTTCCACAGG + Intronic
1001650826 5:173314875-173314897 CTTCCAGTGGCCACTTCCTAAGG - Exonic
1002201405 5:177530799-177530821 CTGCCAGGAGGGCCCTCCTGAGG + Intronic
1002327796 5:178420907-178420929 CTTCCATGAGGGTTTTCCTTGGG - Intronic
1003703267 6:8494513-8494535 CTTCCAGGAGGATCTACTTAGGG + Intergenic
1006982105 6:38155003-38155025 CATCCTGGAGGCCCTTCCTAGGG - Intergenic
1007249236 6:40484402-40484424 CTGCCAGGAGGGACTGCTTTGGG - Intronic
1008574571 6:52847951-52847973 CATCCATGAGAGACTTCCTTGGG + Intronic
1009553291 6:65128058-65128080 CTTCCAGTAAGAACTTCCCATGG + Intronic
1011627376 6:89294472-89294494 TCTCCAAGAGGGACTTCCTGTGG - Intronic
1014989640 6:128057618-128057640 CTTCCAAGAGCCTCTTCCTATGG - Intronic
1015262379 6:131252939-131252961 CTTCAAGGAGGAACATTCTAGGG - Intronic
1019176977 6:170165045-170165067 CTTCCAGGAGTGACTCCCCAGGG + Intergenic
1019645178 7:2125080-2125102 CTGACAGCAGGGACTTCCTGGGG - Intronic
1021514259 7:21465646-21465668 CTTAAAGAAGGGACTTTCTAGGG - Intronic
1025987530 7:66466902-66466924 CTTCCAGGAGGGAGCTCCAAGGG + Intergenic
1026003862 7:66584819-66584841 CTTCCAGGAGGGAGCTCCGAGGG + Intergenic
1026027466 7:66758518-66758540 CTTCCAGGAGGGAGCTCCGAGGG - Intronic
1026844221 7:73688768-73688790 CTTGCAGGGGAGACTTCCTTTGG + Intronic
1031683559 7:124704657-124704679 CATCCAGGAGAGACTTCCCTAGG + Intergenic
1032150348 7:129423963-129423985 TTACCAGGTGGGACCTCCTAGGG - Intronic
1035442908 7:158918324-158918346 GTTCCAGGAGGGTCATCCTTAGG - Intronic
1035833594 8:2725307-2725329 CTTCCAGAAGGCACTGCCAAAGG - Intergenic
1036145965 8:6255050-6255072 TTTCCAGGCGTGACTTCCTGGGG + Intergenic
1038639973 8:29315832-29315854 CCTCCAAGAGGGACTTCGGAAGG + Intergenic
1041505884 8:58596984-58597006 CTTCCAGAAGGGACTTTCTCTGG - Intronic
1042620073 8:70694659-70694681 CTCCCAGGAGTGCCTTCTTAGGG + Intronic
1043772440 8:84222507-84222529 CTTCTAGGAGGGTTTTCTTAAGG + Intronic
1044885374 8:96771373-96771395 TTTCTAGGTGGGACTTTCTAAGG + Intronic
1047798565 8:128284590-128284612 CTTTCAGTAGGGAATTCCTATGG + Intergenic
1047902552 8:129439876-129439898 CTTCCAGGGGTGACTTCCTTTGG - Intergenic
1060557221 9:124514210-124514232 CTTCCAGGAGGCACTTCCTCAGG - Intergenic
1060742093 9:126105634-126105656 CTTCCAGCTGAGACTTCCAAAGG + Intergenic
1060838868 9:126778726-126778748 CTTTCAGGAGGGATATCCTCAGG + Intergenic
1061368513 9:130185129-130185151 CTTCCAGGGGGGATGTCCTTGGG + Intronic
1186367921 X:8914631-8914653 CTTGCAGGAAGGACTTCCCTGGG + Intergenic
1198231236 X:134691637-134691659 TTTCCAGAAGGGCCGTCCTAAGG - Intronic