ID: 967918037

View in Genome Browser
Species Human (GRCh38)
Location 3:194593473-194593495
Sequence ATACCCCATATTTGCAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 695
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 682}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967918037_967918042 26 Left 967918037 3:194593473-194593495 CCTGCCTTGCAAATATGGGGTAT 0: 1
1: 0
2: 0
3: 12
4: 682
Right 967918042 3:194593522-194593544 GTCAGTGTTTACTGCATGGTTGG 0: 1
1: 0
2: 1
3: 10
4: 146
967918037_967918041 22 Left 967918037 3:194593473-194593495 CCTGCCTTGCAAATATGGGGTAT 0: 1
1: 0
2: 0
3: 12
4: 682
Right 967918041 3:194593518-194593540 TGTAGTCAGTGTTTACTGCATGG 0: 1
1: 0
2: 0
3: 21
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967918037 Original CRISPR ATACCCCATATTTGCAAGGC AGG (reversed) Intronic
900855475 1:5178502-5178524 TTTCCCCATATTGGCCAGGCTGG - Intergenic
901376625 1:8844337-8844359 TTTCCCCATATTGGCCAGGCTGG + Intergenic
902025005 1:13376450-13376472 TTTCACCATATTTGCCAGGCTGG - Intergenic
902349214 1:15841002-15841024 TTTCCCCATATTGGCCAGGCTGG + Intergenic
902465121 1:16612937-16612959 AGACCCCAACTTTGCAAGTCAGG + Intronic
902897903 1:19491892-19491914 TTTCCCCATATTGGCCAGGCTGG - Intergenic
903098900 1:21009848-21009870 TTTCACCATATTGGCAAGGCTGG + Intronic
903155685 1:21440734-21440756 AGACCCCAACTTTGCAAGTCAGG - Intronic
903195668 1:21685919-21685941 ATTTCCCATATTGGCCAGGCTGG - Intronic
903876876 1:26480913-26480935 ATTCACCATATTGGCCAGGCTGG + Intergenic
905073274 1:35246737-35246759 TTTCACCATATTTGCCAGGCTGG + Intergenic
905597503 1:39220678-39220700 GTTCCCCATATTGGCCAGGCTGG + Intronic
905660096 1:39715286-39715308 ATTCACCATATTGGCCAGGCTGG + Intronic
905686120 1:39909738-39909760 TTTCCCTATATTTGCTAGGCTGG + Intergenic
905820115 1:40982583-40982605 TTTCCCCATATTGGCCAGGCTGG + Intronic
906194667 1:43922304-43922326 TTTCCCCATATTGGCCAGGCTGG - Intronic
906392327 1:45429201-45429223 TTTCCCCATATTGGCCAGGCTGG - Intronic
907764809 1:57398672-57398694 ACACCCCATGTTTACAAGTCAGG + Intronic
908736801 1:67285034-67285056 TTTCACCATATTGGCAAGGCTGG - Intergenic
910097114 1:83535884-83535906 TTATCCCATGTATGCAAGGCTGG + Intergenic
910189305 1:84578476-84578498 TTTCCCCATATTGGCCAGGCTGG - Intergenic
910582510 1:88844100-88844122 TTTCACCATATTTGCCAGGCTGG + Intergenic
910584433 1:88863550-88863572 TTTCACCATATTTGCCAGGCTGG + Intronic
910599673 1:89017881-89017903 TTTCTCCATATTTGCCAGGCCGG - Intronic
911688572 1:100805405-100805427 TTTCCCCATATTGGCCAGGCTGG + Intergenic
911806579 1:102216862-102216884 TTATCCCAGGTTTGCAAGGCTGG + Intergenic
911873773 1:103132936-103132958 ATACCCAGTAATTGCACGGCTGG + Intergenic
912000288 1:104824655-104824677 TTTCACCATATTTGCCAGGCTGG - Intergenic
913572125 1:120131315-120131337 TTTCACCATATTGGCAAGGCTGG + Intergenic
913600341 1:120415665-120415687 AGACCCCAACTTTGCAAGTCAGG - Intergenic
913994710 1:143642827-143642849 AGACCCCAGCTTTGCAAGTCAGG + Intergenic
914086718 1:144461002-144461024 AGACCCCAACTTTGCAAGTCAGG + Intronic
914361491 1:146939364-146939386 AGACCCCAACTTTGCAAGTCAGG - Intronic
914411344 1:147431068-147431090 TTTCACCATATTGGCAAGGCTGG + Intergenic
914491115 1:148151343-148151365 AGACCCCAACTTTGCAAGTCAGG + Intronic
914590525 1:149102888-149102910 AGACCCCAACTTTGCAAGTCAGG + Intronic
914710001 1:150204418-150204440 TTTCCCCATATTGGCCAGGCTGG + Intergenic
915538025 1:156549263-156549285 ATTCACCATATTGGCCAGGCTGG - Intronic
915689074 1:157669199-157669221 TTTCCCCATATTGGCCAGGCTGG + Intergenic
915855056 1:159374391-159374413 ATCCCTGATATTTGCAAGACAGG - Intergenic
916391093 1:164331644-164331666 TTTCACCATATTGGCAAGGCTGG - Intergenic
916806576 1:168266340-168266362 CTCCCCCATCTTTGCAGGGCTGG - Intergenic
917110707 1:171544317-171544339 ATTCGCCATGTTTGCCAGGCTGG + Intronic
917209122 1:172613775-172613797 TTTCACCATGTTTGCAAGGCTGG - Intergenic
917747760 1:178027225-178027247 ATTCACCATATTGGCCAGGCTGG - Intergenic
918083693 1:181227154-181227176 TTTCACCATATTGGCAAGGCTGG + Intergenic
919852394 1:201681775-201681797 TTTCACCATATTTGCCAGGCTGG - Intronic
919867476 1:201793253-201793275 ATTCTCCAGGTTTGCAAGGCTGG - Intronic
920270473 1:204759360-204759382 TTTCACCATATTTGCCAGGCTGG - Intergenic
921021392 1:211238824-211238846 TTTCACCATATTGGCAAGGCTGG + Intergenic
921442043 1:215199110-215199132 TTTCACCATATTTGCCAGGCTGG - Intronic
922964749 1:229679417-229679439 TTTCACCATATTGGCAAGGCTGG + Intergenic
923283508 1:232467607-232467629 GTACCCAATATTTGCAGGGCAGG - Intronic
923800089 1:237200458-237200480 TTGCACCATATTTGCCAGGCTGG + Intronic
923997957 1:239517908-239517930 TTTCACCATATTTGCCAGGCTGG - Intronic
924020975 1:239781938-239781960 TTATCCCAAATATGCAAGGCTGG - Intronic
924492752 1:244555187-244555209 TTACACCATATTGGCCAGGCTGG - Intronic
1062848861 10:728178-728200 ATTCACCATATTGGCTAGGCTGG - Intergenic
1064042676 10:11981879-11981901 TTTCCCCATATTGGCCAGGCTGG + Intronic
1064067470 10:12194965-12194987 TTTCACCATATTTGCCAGGCTGG - Intronic
1064249938 10:13699270-13699292 TTTCCCCATGTTTGCCAGGCTGG + Intronic
1064410471 10:15099672-15099694 TTTCACCATATTTGCCAGGCTGG + Intronic
1064443813 10:15375919-15375941 TTTCCCCATATTGGCCAGGCTGG + Intergenic
1064584978 10:16830889-16830911 TTTCCCCATATTGGCCAGGCTGG - Intronic
1064848462 10:19683097-19683119 TTTCCCCATATTGGCCAGGCTGG - Intronic
1065215716 10:23446383-23446405 TTTCCCCATATTGGCCAGGCTGG - Intergenic
1065695378 10:28374914-28374936 TTTCACCATATTTGCCAGGCTGG + Intergenic
1065937523 10:30534026-30534048 TTACACCATATTGGCCAGGCTGG + Intergenic
1066039636 10:31534844-31534866 TTTCACCATATTTGCCAGGCTGG - Intergenic
1066054487 10:31667795-31667817 TTTCGCCATATTGGCAAGGCTGG + Intergenic
1066465471 10:35646269-35646291 ATTCCCCATGTTAGCCAGGCTGG - Intergenic
1066498609 10:35967937-35967959 TTATCCCACATATGCAAGGCTGG + Intergenic
1066679864 10:37927313-37927335 ATTCACCATGTTTGCCAGGCTGG - Intergenic
1067105876 10:43366028-43366050 TTTCACCATATTGGCAAGGCTGG - Intergenic
1068660318 10:59616486-59616508 ATACACCTTATTTTTAAGGCTGG + Intergenic
1068772835 10:60841207-60841229 TTACCCCATGTTGGCCAGGCTGG - Intergenic
1069316521 10:67110794-67110816 ATAACAGATATTTTCAAGGCAGG - Intronic
1069676224 10:70250104-70250126 TTTCCCCATATTGGCCAGGCTGG + Exonic
1072442922 10:95472831-95472853 ATTCACCATATTGGCCAGGCTGG - Intronic
1072641465 10:97214214-97214236 TTTCACCATATTGGCAAGGCTGG - Intronic
1073258736 10:102172806-102172828 TTTCCCCATGTTGGCAAGGCTGG + Intergenic
1073396586 10:103223248-103223270 ATTCACCATATTGGCCAGGCTGG + Intergenic
1073534399 10:104262514-104262536 ATTCACCATATTGGCCAGGCTGG - Intronic
1073861186 10:107743111-107743133 TTACACCATATTGGCCAGGCTGG - Intergenic
1074044151 10:109820964-109820986 ATCCCCCTTATTAGGAAGGCTGG - Intergenic
1074073099 10:110093052-110093074 TTTCACCATATTTGCCAGGCTGG + Intronic
1074545936 10:114402861-114402883 ACACCCCAGCTTTGCAAGTCAGG + Intronic
1074560331 10:114529829-114529851 TTTCACCATATTGGCAAGGCTGG - Intronic
1074886609 10:117699003-117699025 ATCACCCACAGTTGCAAGGCTGG + Intergenic
1074950682 10:118331976-118331998 ATTCACCATATTGGCCAGGCTGG - Intronic
1075338934 10:121630068-121630090 TTACACCATGTTGGCAAGGCTGG - Intergenic
1078294394 11:10052521-10052543 ATACTTCAAGTTTGCAAGGCTGG + Intronic
1078489456 11:11755743-11755765 ATACACCACTTTTGAAAGGCAGG + Intergenic
1079509748 11:21197072-21197094 ATACACCATATTGGCTAGGGTGG + Intronic
1080334318 11:31178886-31178908 TTACACCATGTTTGCCAGGCTGG + Intronic
1081069847 11:38597097-38597119 CTTCCCCACATTTCCAAGGCAGG - Intergenic
1081127825 11:39341871-39341893 ACATCCCATCTTTGCAGGGCTGG - Intergenic
1081128678 11:39349907-39349929 TTTCACCATATTGGCAAGGCTGG - Intergenic
1081345659 11:41982490-41982512 ATACCACATTTTGGCAAGACTGG - Intergenic
1081463178 11:43290384-43290406 TTACACCATATTGGCCAGGCTGG - Intergenic
1081466208 11:43320239-43320261 TTTCACCATATTGGCAAGGCTGG + Intronic
1081820328 11:45987462-45987484 TTTCACCATATTTGCCAGGCTGG - Intronic
1082064032 11:47884289-47884311 TTTCACCATATTTGCCAGGCTGG + Intergenic
1082236794 11:49827076-49827098 GTTCCCCATATTGGCCAGGCTGG - Intergenic
1082240241 11:49861570-49861592 TTCCCCCATATTGGCCAGGCTGG - Intergenic
1082618972 11:55397809-55397831 ATTCCCCATTCTAGCAAGGCAGG - Intergenic
1082656408 11:55863561-55863583 TTTCCCCATATTGGCCAGGCTGG + Intergenic
1082796270 11:57380202-57380224 TTTCACCATATTTGCCAGGCTGG - Intronic
1083403034 11:62437552-62437574 TTTCACCATATTGGCAAGGCTGG + Intronic
1084366797 11:68706643-68706665 GTACCCAATATTTGAAATGCAGG - Intergenic
1085113058 11:73905417-73905439 TTTCACCATATTGGCAAGGCTGG + Intronic
1085432123 11:76462039-76462061 TTTCACCATGTTTGCAAGGCTGG - Intronic
1086174344 11:83872066-83872088 TTTCACCATATTTGCCAGGCTGG - Intronic
1087002065 11:93431279-93431301 CTACCAGATCTTTGCAAGGCTGG - Intronic
1088446176 11:109931107-109931129 ATTCCCCATCTCTGCATGGCAGG + Intergenic
1090579834 11:128147904-128147926 TTTCCCCATGTTTGCCAGGCTGG + Intergenic
1090705984 11:129337246-129337268 TTTCCCCATATTGGCCAGGCTGG - Intergenic
1090724288 11:129509418-129509440 ATACCCCATAATGGGATGGCTGG + Intergenic
1092334856 12:7622948-7622970 TTTCACCATATTGGCAAGGCTGG + Intergenic
1092738565 12:11607055-11607077 TTTCACCATATTGGCAAGGCTGG + Intergenic
1093074340 12:14742006-14742028 TTTCACCATGTTTGCAAGGCTGG - Intergenic
1093433722 12:19111794-19111816 ATGCCCCATATTTCCAAGAGTGG - Intergenic
1093506782 12:19876076-19876098 TTATCCCAGATATGCAAGGCTGG - Intergenic
1093732003 12:22575475-22575497 TTTCCCCATATTGGCCAGGCTGG - Intergenic
1093928136 12:24928954-24928976 TTTCCCCATATTGGCCAGGCTGG + Intronic
1093928580 12:24933005-24933027 ATTCACCATATTGGCCAGGCTGG + Intronic
1094660574 12:32466670-32466692 TTACGCCATATTGGCCAGGCTGG - Intronic
1094733748 12:33208485-33208507 TTTCCCCATATTAGCCAGGCTGG + Intergenic
1095391107 12:41707550-41707572 ATTCGCCATATTGGCCAGGCTGG + Intergenic
1095431340 12:42138070-42138092 TTTCCCCATGTTTGCCAGGCTGG - Intronic
1096388820 12:51213727-51213749 TTTCCCCATATTGGCCAGGCTGG + Intronic
1096405084 12:51338041-51338063 TTTCACCATGTTTGCAAGGCTGG - Intronic
1096816440 12:54204720-54204742 ATTCCCCATGTTGGCCAGGCTGG - Intergenic
1097116439 12:56700760-56700782 ATTCACCATATTGGCCAGGCTGG + Intergenic
1097436634 12:59557983-59558005 TTTCCCCATATTGGCCAGGCTGG - Intergenic
1097515895 12:60605612-60605634 TTACACCATGTTTGCCAGGCTGG - Intergenic
1098531418 12:71546115-71546137 TTTCCCCATGTTTGCCAGGCTGG - Intronic
1098531604 12:71547800-71547822 TTTCCCCATGTTTGCCAGGCTGG + Intronic
1099615790 12:84933664-84933686 TTTCACCATATTGGCAAGGCAGG + Intergenic
1100549226 12:95631211-95631233 TTACACCATATTGGCCAGGCTGG - Intergenic
1101405396 12:104424198-104424220 ATAACCCAGCTTTGCAAGGGAGG + Intergenic
1103649373 12:122421766-122421788 AAACCCGATTTTTGAAAGGCAGG + Intronic
1103697482 12:122828442-122828464 TTTCACCATATTGGCAAGGCTGG + Intergenic
1104059221 12:125253627-125253649 ATTCACCATATTTCCCAGGCTGG + Intronic
1104341852 12:127957624-127957646 ATACCCCATAGATGCCAGCCTGG + Intergenic
1104716966 12:131022172-131022194 ACATCCCATATTTGCTATGCTGG - Intronic
1106632827 13:31494882-31494904 TTACCCAATATTTGCAAGTATGG + Intergenic
1107085558 13:36424283-36424305 TTTCCCCATATTGGCCAGGCTGG - Intergenic
1107169506 13:37323282-37323304 TTTCACCATATTTGCCAGGCTGG + Intergenic
1107369622 13:39730576-39730598 TTTCACCATATTGGCAAGGCTGG - Intronic
1107507653 13:41050744-41050766 TTTCACCATATTTGCCAGGCTGG + Intronic
1108017973 13:46096074-46096096 ATTCACCATATTGGTAAGGCTGG + Intronic
1108646117 13:52430433-52430455 TTTCACCATATTGGCAAGGCTGG - Intronic
1109345585 13:61111893-61111915 ATCCCCAATATTTGGAAGACAGG - Intergenic
1110848459 13:80217148-80217170 TTTCCCCATATTGGCCAGGCTGG + Intergenic
1112125239 13:96458906-96458928 ATTCACCATGTTTGCCAGGCTGG - Intronic
1112810855 13:103216916-103216938 ATACCTCATATGTATAAGGCAGG - Intergenic
1112949598 13:104976158-104976180 TTTCCCCATATTGGCCAGGCTGG - Intergenic
1113835732 13:113327373-113327395 TTTCACCATATTTGCCAGGCTGG + Intronic
1114481908 14:23041322-23041344 ATTCACCATATTGGCCAGGCTGG + Intergenic
1114517957 14:23312263-23312285 TTTCCCCATATTGGCCAGGCTGG - Intronic
1115221700 14:31064515-31064537 ATTCACCATATTGGCCAGGCTGG + Intronic
1115698981 14:35930377-35930399 TTTCACCATATTTGCCAGGCTGG + Intronic
1115839921 14:37458621-37458643 TTTCCCCATGTTTGCCAGGCTGG - Intronic
1115901705 14:38158232-38158254 TTACACCATATTGGCCAGGCTGG + Intergenic
1116282476 14:42926974-42926996 TTTCCCCATGTTGGCAAGGCTGG + Intergenic
1116333817 14:43631135-43631157 TTTCACCATATTGGCAAGGCTGG - Intergenic
1116716238 14:48430723-48430745 TTTCACCATATTTGCAAGGCTGG + Intergenic
1116834537 14:49757498-49757520 TTATCCCAGATATGCAAGGCTGG - Intergenic
1117142784 14:52806729-52806751 ATTCACCATATTGGCCAGGCTGG + Intergenic
1118369469 14:65125180-65125202 TTTCACCATATTGGCAAGGCTGG - Intergenic
1119197628 14:72729050-72729072 ATTCACCATGTTTGCCAGGCTGG - Intronic
1120307408 14:82788370-82788392 GTGCCCCAAATTTGGAAGGCAGG + Intergenic
1120344034 14:83261223-83261245 TTATCCCATGTATGCAAGGCTGG - Intergenic
1120819740 14:88901053-88901075 ATATCTCACATTGGCAAGGCTGG - Intergenic
1121018774 14:90566154-90566176 ATTCCACATATTGGCCAGGCTGG - Intronic
1121043023 14:90765762-90765784 ATACCCAATATTTGGAGGACAGG - Intronic
1121506759 14:94483579-94483601 TTTCCCCATATTGGCCAGGCTGG + Intergenic
1122489785 14:102106737-102106759 TTTCCCCATGTTGGCAAGGCTGG + Intronic
1122524802 14:102373881-102373903 TTTCCCCATATTGGCCAGGCTGG - Intronic
1123560782 15:21488001-21488023 ATTCACCATGTTTGCCAGGCTGG + Intergenic
1123957365 15:25351664-25351686 TTCCCCCATGTTTGCCAGGCTGG + Intronic
1124567183 15:30827042-30827064 TTTCCCCATATTGGCCAGGCTGG + Intergenic
1125030719 15:35073207-35073229 TTTCCCCATGTTGGCAAGGCTGG + Intergenic
1125550873 15:40543648-40543670 TTTCCCCATATTGGCCAGGCTGG + Intronic
1125632197 15:41156343-41156365 TTACACCATATTGGCCAGGCTGG + Intergenic
1126511438 15:49479807-49479829 TTTCACCATATTTGCCAGGCTGG + Intronic
1126586321 15:50291521-50291543 TTACACCATATTGGCCAGGCTGG + Intronic
1126701473 15:51371878-51371900 TTTCCCCATATTGGCCAGGCTGG + Intronic
1126827424 15:52566049-52566071 TTTCCCCATATTGGCCAGGCTGG + Intronic
1127092804 15:55483290-55483312 ATTCACCATATTGGCCAGGCTGG + Intronic
1127264107 15:57347283-57347305 ATACACAGTATTTTCAAGGCAGG - Intergenic
1127494691 15:59498848-59498870 ATTCGCCATATTGGCCAGGCTGG + Intronic
1128266690 15:66273048-66273070 TTTCCCCATATTGGCCAGGCTGG - Intergenic
1128369110 15:67026586-67026608 TTTCCCCATGTTGGCAAGGCTGG + Intergenic
1128533077 15:68468450-68468472 TTCCCCCATGTTTGCCAGGCTGG - Intergenic
1129799662 15:78404791-78404813 TTTCACCATATTGGCAAGGCTGG - Intergenic
1129873634 15:78957833-78957855 ATACAACAACTTTGCAAGGCAGG + Intergenic
1130292881 15:82620209-82620231 ATTCACCATATTGGCAAGGCTGG - Intronic
1131166724 15:90147200-90147222 TTTCCCCATATTGGCCAGGCTGG - Intergenic
1131244521 15:90779080-90779102 TTTCCCCATATTGGCCAGGCTGG + Intronic
1131246008 15:90793590-90793612 ATATCTCATCTTTGCAAAGCTGG - Intronic
1131298809 15:91176400-91176422 ATACCCCGTAATTGGATGGCTGG + Intronic
1131461835 15:92622958-92622980 TTTCCCCATATTGGCCAGGCTGG - Intronic
1131480915 15:92781146-92781168 ATTCACCAGATTTGCCAGGCTGG - Intronic
1131601434 15:93853228-93853250 TTACACCATATTGGCCAGGCTGG - Intergenic
1132483667 16:179054-179076 TTTCCCCATATTGGCCAGGCTGG - Intergenic
1133096108 16:3447036-3447058 TTTCCCCATATTGGCCAGGCTGG + Intronic
1133448871 16:5886690-5886712 TTTCCCCATATTGGCCAGGCTGG - Intergenic
1133611400 16:7436864-7436886 CTTCGCCATATTTGCCAGGCTGG - Intronic
1134478780 16:14599236-14599258 TTTCCCCATATTTCCCAGGCTGG + Intronic
1134886973 16:17801967-17801989 TTTCACCATATTGGCAAGGCTGG + Intergenic
1135521295 16:23180562-23180584 TTTCACCATGTTTGCAAGGCTGG - Intergenic
1135571486 16:23552684-23552706 ATTCGCCATGTTGGCAAGGCTGG + Intronic
1136387699 16:29939996-29940018 ATTCACCATATTGGCCAGGCTGG + Intergenic
1136405187 16:30041459-30041481 AGACACCATATTGGCCAGGCTGG + Intronic
1137473485 16:48784734-48784756 TTACCCCAGATATGCAGGGCTGG - Intergenic
1139069163 16:63359047-63359069 TTTCACCATATTTGCCAGGCTGG - Intergenic
1139394096 16:66626237-66626259 TTTCACCATATTTGCCAGGCTGG - Intronic
1139543332 16:67635359-67635381 TTTCACCATATTTGCCAGGCTGG + Intronic
1139554543 16:67698672-67698694 TTTCCCCATATTGGCCAGGCTGG + Intronic
1140096636 16:71881777-71881799 TTTCCCCATATTGGCCAGGCTGG - Intronic
1140259344 16:73363975-73363997 TTTCACCATATTGGCAAGGCTGG - Intergenic
1140922754 16:79553891-79553913 TTTCACCATATTTGCCAGGCTGG - Intergenic
1141084978 16:81087328-81087350 TTTCCCCATGTTGGCAAGGCTGG - Intronic
1141534644 16:84670623-84670645 CTTCCCCATATTGGCCAGGCTGG + Intergenic
1141885246 16:86887500-86887522 ACATCCCACGTTTGCAAGGCAGG - Intergenic
1142198528 16:88750137-88750159 ATTCACCATATTGGCCAGGCTGG - Intronic
1142381850 16:89737322-89737344 TTACACCATATTGGCCAGGCTGG - Intronic
1142625270 17:1187692-1187714 TTACACCATATTGGCCAGGCTGG - Intronic
1142849926 17:2699825-2699847 TTTCCCCATATTGGCCAGGCTGG + Intronic
1142859177 17:2750354-2750376 ATACACCATGTTGGCCAGGCTGG - Intergenic
1143179612 17:4976199-4976221 TTTCACCATATTTGCCAGGCTGG + Intronic
1143453063 17:7048135-7048157 TTTCACCATATTTGCCAGGCTGG + Intergenic
1143886909 17:10071727-10071749 TTTCACCATATTGGCAAGGCTGG - Intronic
1143946280 17:10595474-10595496 TTTCCCCATATTGGCCAGGCTGG + Intergenic
1144007179 17:11111305-11111327 TTTCCCCATATTGGCCAGGCTGG - Intergenic
1144048499 17:11475603-11475625 ATACCCCAGGTATGCAAAGCTGG - Intronic
1144248209 17:13389022-13389044 TTACACCATATTGGCCAGGCTGG - Intergenic
1144681133 17:17195490-17195512 TTTCCCCATATTGGCCAGGCTGG - Intronic
1144813076 17:18014113-18014135 ATTCACCATATTGGCCAGGCTGG + Intronic
1145244607 17:21260309-21260331 TTTCACCATATTTGCCAGGCTGG + Intergenic
1145803045 17:27703159-27703181 TTTCCCCATATTGGCCAGGCTGG + Intergenic
1145871061 17:28273563-28273585 TTTCCCCATGTTGGCAAGGCTGG - Intergenic
1146196334 17:30816084-30816106 TTTCACCATATTTGCCAGGCTGG - Intronic
1146941919 17:36849278-36849300 TTTCGCCATATTTGCCAGGCTGG - Intergenic
1147141366 17:38462449-38462471 ATTCACCATATTGGCCAGGCTGG + Intronic
1147173450 17:38635628-38635650 ATTCGCCATATTGGCCAGGCTGG + Intergenic
1147174996 17:38649897-38649919 TTTCGCCATATTTGCCAGGCTGG + Intergenic
1147611959 17:41807137-41807159 GTGCCCCATATTTGCCAGCCTGG + Intronic
1147730214 17:42595300-42595322 AGACACCATATTGGCTAGGCTGG + Intronic
1147809317 17:43156039-43156061 TTTCCCCATATTGGCTAGGCTGG - Intergenic
1149329626 17:55567642-55567664 TCACCCCCTATTTGCAATGCTGG - Intergenic
1149353906 17:55819553-55819575 ATTCCCTATATTTCCTAGGCTGG - Intronic
1149658261 17:58321491-58321513 ATTCACCATATTGGCCAGGCTGG + Intronic
1149709557 17:58728045-58728067 TTTCCCCATATTGGCCAGGCTGG - Intronic
1150765968 17:68002455-68002477 TTTCCCCATATTGGCCAGGCTGG + Intergenic
1151273589 17:73015776-73015798 TTTCCCCATATTGGCCAGGCTGG + Intronic
1152418820 17:80180956-80180978 TTTCACCATATTTGCCAGGCTGG + Intronic
1153017971 18:601445-601467 ATTCACCATATTGGCCAGGCTGG - Intronic
1153355360 18:4128714-4128736 ATACCCCAGACCTCCAAGGCTGG + Intronic
1153862368 18:9226125-9226147 ATACAGAATATTTCCAAGGCCGG + Intronic
1154203739 18:12319338-12319360 TTTCCCCATATTGGCCAGGCTGG + Intronic
1154269298 18:12905543-12905565 TTACCCCATCTTGGCCAGGCTGG - Intronic
1154488021 18:14893413-14893435 TTTCACCATATTTGCCAGGCTGG - Intergenic
1154530658 18:15341427-15341449 ATTCACCATATTGGCCAGGCTGG + Intergenic
1155036324 18:22027793-22027815 ATACACCATTTTGGCCAGGCTGG - Intergenic
1155187831 18:23402907-23402929 TTTCCCCATATTGGCCAGGCTGG - Intronic
1155285184 18:24281279-24281301 ATTCACCATATTGGCCAGGCTGG + Intronic
1156082228 18:33351386-33351408 TTTCACCATATTGGCAAGGCTGG + Intronic
1156307927 18:35896522-35896544 ATTCACCATATTGGCCAGGCTGG + Intergenic
1157024640 18:43828375-43828397 TTTCCCCATATTGGCCAGGCTGG + Intergenic
1158718087 18:59898810-59898832 TTTCACCATATTGGCAAGGCTGG + Intergenic
1158826393 18:61224964-61224986 TTTCCCCATATTTGTAAAGCGGG - Intergenic
1158986873 18:62826803-62826825 TTTCCCCATATTGGCCAGGCTGG - Intronic
1159683362 18:71384190-71384212 ATTTCCAATATTTGGAAGGCAGG - Intergenic
1159875561 18:73806931-73806953 ATTCCCCATATTGGTCAGGCTGG + Intergenic
1161156372 19:2733744-2733766 TTTCCCCATATTGGCCAGGCTGG - Intronic
1161304468 19:3559227-3559249 TTTCCCCATATTGGCCAGGCTGG + Intronic
1161362312 19:3857507-3857529 ATACACCATGTTGGCCAGGCTGG - Intronic
1161421889 19:4180574-4180596 ATTCACCATATTGGCCAGGCTGG + Intronic
1161695008 19:5761931-5761953 TTTCACCATATTGGCAAGGCTGG + Intronic
1161839759 19:6672438-6672460 TTTCCCCATATTGGCCAGGCTGG - Intergenic
1162238728 19:9329857-9329879 TTTCACCATATTGGCAAGGCTGG + Intronic
1162590820 19:11589965-11589987 TTTCCCCATGTTTGCCAGGCTGG + Intronic
1162603905 19:11692569-11692591 TTTCACCATATTGGCAAGGCTGG + Intergenic
1162614234 19:11784418-11784440 ATCCCCAATATTTGGAAGACAGG + Intergenic
1163257485 19:16165636-16165658 ATTCCCCATGTTGGCCAGGCTGG + Intronic
1163486217 19:17588091-17588113 TTTCCCCATATTGGCCAGGCTGG - Intergenic
1163747864 19:19058723-19058745 TTTCACCATATTGGCAAGGCTGG - Intronic
1163874716 19:19858245-19858267 TTTCACCATATTTGCCAGGCTGG - Intergenic
1163930153 19:20381966-20381988 ATTCACCATATTGGCCAGGCTGG + Intergenic
1164242060 19:23397995-23398017 TTTCACCATATTTGCCAGGCTGG - Intergenic
1164319987 19:24135731-24135753 ATGCACCATATTGGCCAGGCTGG + Intergenic
1164549153 19:29193758-29193780 TTTCACCATATTGGCAAGGCTGG - Intergenic
1165207121 19:34199324-34199346 TTTCCCCATATTTTCCAGGCTGG + Intronic
1165807332 19:38588493-38588515 ATTCACCATATTGGCCAGGCTGG - Intronic
1165822941 19:38688351-38688373 ATTCACCATGTTTGCCAGGCTGG - Intronic
1165836531 19:38760363-38760385 ATTCACCATATTGGCCAGGCTGG - Intronic
1166115673 19:40652569-40652591 TTTCCCCATATTGGCCAGGCTGG + Intergenic
1167029690 19:46949644-46949666 ACACCCCACCTTTGCCAGGCAGG + Intronic
1167200694 19:48063237-48063259 TTTCCCCATCTTGGCAAGGCTGG + Intronic
1167567165 19:50263859-50263881 TTTCCCCATATTGGCCAGGCTGG - Intronic
1167667104 19:50828770-50828792 TTTCCCCATATTGGCCAGGCTGG - Intronic
1167819200 19:51910566-51910588 ATTCACCATATTGGCCAGGCTGG - Intronic
1167845235 19:52157764-52157786 TTTCCCCATATTGGCCAGGCTGG + Intronic
1168519444 19:57036901-57036923 ATGCACCATATTGGCCAGGCTGG - Intergenic
1168538765 19:57192924-57192946 TTTCACCATATTTGCCAGGCTGG + Intronic
925521187 2:4747538-4747560 ATTCACCATATTGGCCAGGCTGG - Intergenic
925808271 2:7673683-7673705 AGACCCCAGACTTGCATGGCTGG - Intergenic
927965873 2:27267737-27267759 TTTCCCCATATTGGCCAGGCTGG - Intronic
928506698 2:31961160-31961182 ATTCCCCATGTTGGCCAGGCTGG - Intronic
928555741 2:32423123-32423145 TTTCCCCATATTGGCCAGGCTGG + Intronic
928652991 2:33421634-33421656 TTTCCCCATATTGGCCAGGCTGG - Intergenic
928984401 2:37166786-37166808 TTTCCCCATATTTGCCAGGCTGG + Intergenic
929462294 2:42111556-42111578 TTTCACCATATTTGCCAGGCTGG - Intergenic
929865276 2:45712348-45712370 GTTCCCCATATTGGCCAGGCTGG + Intronic
930736399 2:54784477-54784499 ACACCCAATATTGGCAAAGCAGG - Intronic
930819449 2:55630856-55630878 TTACACCATATTGGCCAGGCTGG - Intergenic
931029668 2:58158134-58158156 ATAGCTCACATGTGCAAGGCTGG - Intronic
931160818 2:59688488-59688510 ATACCCCATAATGGGATGGCTGG - Intergenic
931272761 2:60717313-60717335 TTTCCCCATATTGGCCAGGCTGG + Intergenic
931361034 2:61578107-61578129 TTACACCATATTGGCCAGGCTGG - Intergenic
931488602 2:62719957-62719979 ATACCACATTTTTGCAAAGCTGG + Intronic
931602893 2:64021027-64021049 TTTCACCATATTTGCCAGGCTGG + Intergenic
931831372 2:66054952-66054974 TTTCCCCATGTTGGCAAGGCTGG + Intergenic
932075170 2:68655992-68656014 ATGCCTAACATTTGCAAGGCTGG + Intergenic
932638263 2:73412592-73412614 CTACACCATATTGGCCAGGCTGG - Intronic
932911414 2:75809918-75809940 TTTCACCATATTGGCAAGGCTGG - Intergenic
933443048 2:82338600-82338622 ATTCACCATGTTGGCAAGGCTGG - Intergenic
933666565 2:84970293-84970315 AAACTCCAAATTTTCAAGGCAGG + Intergenic
934090031 2:88543203-88543225 TTTCACCATATTGGCAAGGCTGG + Intergenic
934315741 2:91917997-91918019 ATACTCTAACTTTGCAAGGCTGG - Intergenic
936106927 2:109632614-109632636 AAACACCATATTGGCCAGGCTGG - Intergenic
936545099 2:113385201-113385223 TTTCCCCATATTGGCCAGGCAGG - Intergenic
936958946 2:118053097-118053119 TTCCACCAGATTTGCAAGGCAGG + Intergenic
937942328 2:127295627-127295649 ATTCACCATATTGGCCAGGCTGG - Intergenic
937995816 2:127694159-127694181 TTTCACCATATTTGCCAGGCTGG + Intergenic
938240793 2:129741104-129741126 ATACACTATATTTTTAAGGCAGG - Intergenic
938372265 2:130778569-130778591 TTTCACCATATTTGCCAGGCTGG - Intergenic
938415117 2:131097792-131097814 ATTCACCATATTGGCCAGGCTGG - Intergenic
939296858 2:140277388-140277410 TTTCACCATATTTGCTAGGCTGG - Intronic
940314244 2:152310521-152310543 TTTCCCCATATTGGCCAGGCTGG - Intergenic
940333503 2:152500990-152501012 TTAGCCCATACTGGCAAGGCAGG + Intronic
940917789 2:159276255-159276277 TTTCCCCATATTGGCCAGGCTGG + Intronic
941002111 2:160213121-160213143 TTTCACCATATTGGCAAGGCTGG + Intronic
941664926 2:168235233-168235255 TTTCACCATATTGGCAAGGCTGG + Intronic
941813630 2:169779021-169779043 TTTCCCCATATTTGTTAGGCTGG + Intergenic
942039236 2:172041261-172041283 ATTCACCATATTGGCCAGGCTGG - Intronic
942578030 2:177386123-177386145 TTTCGCCATATTGGCAAGGCTGG + Intronic
943585511 2:189734766-189734788 TTTCACCATATTGGCAAGGCTGG - Intronic
944460063 2:199939296-199939318 ATTCCCCATGTTGGCCAGGCTGG + Intronic
944461370 2:199954295-199954317 ATTCACCATATTGGCCAGGCTGG + Intronic
944779977 2:203007848-203007870 TTTCACCATATTTGCCAGGCTGG + Intronic
945730430 2:213525482-213525504 TTTCACCATATTAGCAAGGCTGG + Intronic
946218622 2:218206592-218206614 ATTCCCCATGTTGGCCAGGCTGG + Intergenic
947432170 2:230040416-230040438 TTTCCCCATGTTGGCAAGGCTGG + Intronic
947779216 2:232742343-232742365 TTTCCCCATATTTGTCAGGCTGG - Intronic
948252805 2:236544183-236544205 TTTCACCATATTGGCAAGGCTGG + Intergenic
948915259 2:241031358-241031380 TTTCCCCATATTGGCCAGGCTGG + Intronic
1169010629 20:2247198-2247220 TTTCCCCATATTGGCCAGGCTGG + Intergenic
1169128917 20:3152710-3152732 TTTCCCCATATTGGCTAGGCTGG - Intronic
1169253682 20:4081164-4081186 TTTCACCATATTGGCAAGGCTGG - Intergenic
1169381489 20:5111411-5111433 TTTCCCCATATTGGCCAGGCTGG - Intronic
1170174005 20:13447182-13447204 ATACCCAGTTTTTGTAAGGCTGG - Intronic
1170647710 20:18211749-18211771 TTTCCCCATGTTTGCCAGGCTGG - Intergenic
1170958875 20:21007228-21007250 TTTCACCATATTTGCCAGGCTGG + Intergenic
1171352042 20:24510371-24510393 TTTCCCCATATTGGCCAGGCTGG - Intronic
1171565291 20:26178941-26178963 AGACACCATATTGGCCAGGCTGG + Intergenic
1172611967 20:36259294-36259316 CTATCTCTTATTTGCAAGGCTGG + Intronic
1172668367 20:36616528-36616550 TTTCACCATATTTGCCAGGCTGG + Intronic
1172688087 20:36772482-36772504 TTTCCCCATATTGGCCAGGCTGG + Intronic
1172730956 20:37087137-37087159 ATTCACCATATTAGCCAGGCTGG - Intronic
1172734272 20:37114381-37114403 TTTCCCCATATTGGCCAGGCTGG - Intronic
1172921218 20:38483991-38484013 ATTCACCATATTGGCCAGGCTGG - Intronic
1175106110 20:56616240-56616262 TTTCCCCATATTGGCCAGGCTGG + Intergenic
1176766751 21:13027026-13027048 ATTCACCATATTGGCCAGGCTGG - Intergenic
1176793255 21:13345923-13345945 TTTCACCATATTTGCCAGGCTGG + Intergenic
1176907360 21:14518488-14518510 ATACCTTATATTTGCAAGAAAGG + Intronic
1177106617 21:16964479-16964501 TTTCACCATATTTGCCAGGCTGG + Intergenic
1177800122 21:25820389-25820411 TTACACCATATTGGCCAGGCTGG + Intergenic
1178142063 21:29695668-29695690 ATTCACCATATTGGCCAGGCTGG + Intronic
1178187768 21:30243409-30243431 TTTCCCCATATTGGCCAGGCTGG - Intergenic
1178531506 21:33380200-33380222 TTTCACCATATTTGCCAGGCTGG - Intergenic
1178868877 21:36354498-36354520 TTTCCCCATATTGGCCAGGCTGG + Intronic
1179216332 21:39370195-39370217 TTACACCATGTTGGCAAGGCTGG - Intergenic
1181712445 22:24699010-24699032 TTTCACCATATTTGCCAGGCTGG + Intergenic
1182200923 22:28568949-28568971 TTTCACCATATTGGCAAGGCTGG - Intronic
1182427971 22:30284849-30284871 ACACCCCAGATTTCAAAGGCAGG + Intergenic
1182478980 22:30594322-30594344 TTTCACCATATTTGCCAGGCTGG - Intronic
1182705898 22:32280209-32280231 TTTCCCCATATTGGCCAGGCTGG + Intergenic
1182734461 22:32521641-32521663 TTTCCCCATATTGGCCAGGCTGG + Intronic
1183143202 22:35963939-35963961 TTACACCATATTGGCCAGGCTGG + Intronic
1183194801 22:36345949-36345971 TTTCCCCATATTGGCCAGGCTGG - Intronic
1183203610 22:36403092-36403114 TTTCCCCATATTGGCCAGGCTGG + Intergenic
1183225989 22:36550231-36550253 TTTCACCATATTGGCAAGGCTGG - Intergenic
1183410366 22:37651523-37651545 TTACCCCATGTTGGCCAGGCTGG + Intronic
1183896865 22:40976300-40976322 TTTCGCCATATTTGCCAGGCTGG - Intergenic
1183906494 22:41044907-41044929 GTTCCCCATGTTGGCAAGGCTGG + Intergenic
1183967846 22:41453661-41453683 TTTCCCCATGTTGGCAAGGCTGG - Intergenic
1184220029 22:43094157-43094179 AGTTCCCATATTTACAAGGCAGG - Intergenic
1184378655 22:44131335-44131357 TTTCACCATATTTGCCAGGCTGG + Intronic
1185369143 22:50451989-50452011 TTTCACCATATTTGCCAGGCTGG + Intronic
949113616 3:293304-293326 TTTCCCCATGTTGGCAAGGCTGG - Intronic
949615962 3:5754044-5754066 TTTCACCATATTTGCCAGGCTGG + Intergenic
950870682 3:16225839-16225861 AAAACCCATATTGGCCAGGCTGG - Intronic
953647007 3:44764830-44764852 TTTCACCATATTGGCAAGGCTGG + Intronic
954022112 3:47751343-47751365 TTTCCCCATATTGGCCAGGCTGG - Intronic
954085661 3:48242005-48242027 TTTCGCCATATTTGCCAGGCTGG + Intronic
954088393 3:48265165-48265187 TTTCGCCATATTTGCCAGGCTGG + Intronic
954203616 3:49041163-49041185 TTTCCCCATATTGGCCAGGCTGG + Intronic
954739882 3:52740600-52740622 TTTCACCATATTGGCAAGGCTGG - Intronic
956143996 3:66173853-66173875 TTACACCATATTGGCCAGGCTGG - Intronic
956570715 3:70691257-70691279 ATACCCCATAATGGGAATGCTGG + Intergenic
956613444 3:71147309-71147331 AGACCCCATCTTTGAAAGGCAGG - Intronic
956645494 3:71451704-71451726 ATACACCATATTTTCAACACTGG + Intronic
958137579 3:89515776-89515798 ATCCCCCTTCTTTGCAATGCTGG + Intergenic
959008843 3:101050734-101050756 TTTCGCCATATTGGCAAGGCTGG - Intergenic
959224544 3:103563285-103563307 ATCCCACATATTTGGGAGGCAGG - Intergenic
959402271 3:105917455-105917477 TTTCCCCATGTTGGCAAGGCTGG + Intergenic
961246411 3:125457770-125457792 ATTCTCCATATTGGCCAGGCTGG + Intronic
961875233 3:130017531-130017553 AGAGCCCATATTGGCCAGGCTGG + Intergenic
963474045 3:145780848-145780870 TTTCACCATATTTGCCAGGCTGG + Intergenic
963894349 3:150669701-150669723 TTACCCCAGATATGCAAGGTTGG + Intronic
964854689 3:161133974-161133996 TTTCACCATATTGGCAAGGCTGG + Intronic
964948729 3:162260946-162260968 TTACACCATATTGGCCAGGCTGG - Intergenic
966336256 3:178871619-178871641 TTTCACCATATTTGCCAGGCTGG + Intergenic
966650033 3:182290366-182290388 TTTCCCCATATTGGCAAGGCTGG - Intergenic
966792507 3:183686598-183686620 TTTCACCATATTTGCCAGGCTGG + Intergenic
967562450 3:190932845-190932867 TTTCACCATGTTTGCAAGGCTGG - Intergenic
967853840 3:194101719-194101741 ATAACCCTTATTTGCAAGCTGGG + Intergenic
967918037 3:194593473-194593495 ATACCCCATATTTGCAAGGCAGG - Intronic
968403641 4:319860-319882 TTTCCCCATATTGGCCAGGCTGG - Intergenic
969026686 4:4178791-4178813 TTTCCCCATATTGGCCAGGCTGG + Intergenic
969484221 4:7462938-7462960 AGTCCCCATATTGGCAAGCCTGG - Intronic
970198140 4:13573717-13573739 TTTCACCATATTGGCAAGGCTGG + Intronic
970354292 4:15236736-15236758 TTTCACCATATTGGCAAGGCTGG - Intergenic
970848988 4:20579096-20579118 TTTCACCATATTGGCAAGGCTGG - Intronic
971045690 4:22802734-22802756 ATTCACCATATTGGCCAGGCTGG + Intergenic
971411599 4:26378829-26378851 TTTCACCATATTTGCCAGGCTGG - Intronic
971790880 4:31168451-31168473 TTTCCCCATGTTGGCAAGGCTGG + Intergenic
972155058 4:36150448-36150470 TTACACCATATTGGCCAGGCTGG - Intronic
972974215 4:44613682-44613704 TTTCACCATATTTGCCAGGCTGG - Intergenic
973046323 4:45537837-45537859 TTTCACCATATTTGCCAGGCTGG - Intergenic
973621898 4:52735219-52735241 ATCCCCCATCTTTACAAGACAGG + Intronic
974293818 4:59968537-59968559 ATATCCAATATTTGCCTGGCTGG - Intergenic
975064673 4:70045762-70045784 AAACCCCATATGTCAAAGGCAGG - Intergenic
975573551 4:75841124-75841146 TTTCACCATATTTGCCAGGCTGG + Intergenic
976129841 4:81872005-81872027 ATTCACCATATTGGCCAGGCTGG - Intronic
976430860 4:84962867-84962889 ATTCACCATATTGGCCAGGCTGG + Intronic
976790397 4:88871742-88871764 ATTCCCCAACTTAGCAAGGCAGG + Intronic
976837399 4:89390791-89390813 ATTCCCCAACTTAGCAAGGCAGG + Intergenic
977941572 4:102865294-102865316 TTTCACCATATTTGCCAGGCTGG - Intronic
978032660 4:103954351-103954373 TTTCACCATATTTGCCAGGCTGG - Intergenic
979217654 4:118184481-118184503 AAGCCCCAGATTTGCAGGGCTGG - Intronic
980074625 4:128281891-128281913 ATACCCAATCTTTGTATGGCTGG + Intronic
980783191 4:137517744-137517766 TTTCACCATATTTGCCAGGCTGG + Intergenic
980922154 4:139097418-139097440 TTCACCCATATTTGCCAGGCTGG - Intronic
981131730 4:141164401-141164423 CTTCCCCAAATTAGCAAGGCAGG + Intronic
982799665 4:159688447-159688469 ATCCCCAATATTTGAAAGACAGG - Intergenic
982862582 4:160471622-160471644 TTTCACCATATTTGCCAGGCTGG - Intergenic
983382586 4:167016735-167016757 TTTCACCATATTGGCAAGGCTGG + Intronic
986057444 5:4152817-4152839 TTTCCCCATATTGGCCAGGCTGG + Intergenic
986147269 5:5090302-5090324 ATACCTAATATGTGCAAGTCTGG - Intergenic
986880086 5:12159125-12159147 ATACCCCATAATGGGATGGCTGG - Intergenic
987575480 5:19723033-19723055 ATTCACCATGTTTGCCAGGCTGG - Intronic
987637907 5:20569423-20569445 TTTCCCCATATTGGCCAGGCTGG - Intronic
988043493 5:25917517-25917539 TTACACCATATTGGCCAGGCTGG - Intergenic
988590384 5:32543822-32543844 TTTCACCATATTGGCAAGGCTGG + Intronic
991733800 5:69613539-69613561 TTTCTCCATATTTGCGAGGCTGG + Intergenic
991810234 5:70468681-70468703 TTTCTCCATATTTGCGAGGCTGG + Intergenic
991860467 5:71008607-71008629 TTTCTCCATATTTGCGAGGCTGG - Intronic
991909270 5:71545524-71545546 ATTCGCCATATTGGCCAGGCTGG + Intronic
993325221 5:86526199-86526221 ATACCCCATAGTTCCTAGACTGG - Intergenic
993377804 5:87170247-87170269 TTTCACCATATTTGCCAGGCTGG + Intergenic
993384790 5:87251576-87251598 TTTCCCCATATTGGCCAGGCTGG + Intergenic
993992847 5:94681325-94681347 TTTCACCATGTTTGCAAGGCTGG + Intronic
995792506 5:115905958-115905980 TTTCACCATATTTGCCAGGCTGG - Intronic
996733989 5:126742080-126742102 TTTCCCCATATTGGCCAGGCTGG + Intergenic
998029703 5:138855232-138855254 ATTCACCATATTGGCCAGGCTGG + Intronic
998161622 5:139815796-139815818 TTTCCCCATATTGGCCAGGCTGG - Intronic
998579333 5:143354725-143354747 ATTCCCCATGTTGGCCAGGCTGG - Intronic
998858249 5:146416595-146416617 ATTCACCATATTGGCCAGGCTGG + Intergenic
999831672 5:155326193-155326215 CTACACCATATTGGCCAGGCTGG + Intergenic
1000325836 5:160171358-160171380 TTTCACCATATTGGCAAGGCTGG + Intergenic
1000706753 5:164522059-164522081 ATTCACCATATTGGCCAGGCTGG - Intergenic
1001597677 5:172908379-172908401 TTTCACCATATTGGCAAGGCTGG - Intronic
1001612237 5:173012225-173012247 TTTCCCCATATTGGCCAGGCTGG + Intronic
1002821613 6:730522-730544 ATTGCCCACATTTTCAAGGCTGG + Intergenic
1003683895 6:8282117-8282139 TTTCCCCATATTGGCCAGGCTGG + Intergenic
1004377849 6:15106240-15106262 TTTCACCATATTTGCCAGGCTGG + Intergenic
1004549129 6:16629524-16629546 TTTCACCATGTTTGCAAGGCTGG + Intronic
1004625755 6:17375341-17375363 TTTCACCATATTGGCAAGGCTGG + Intergenic
1004693483 6:18012426-18012448 TTTCACCATATTTGCCAGGCTGG + Intergenic
1004803281 6:19174604-19174626 GTACCCCATGTTGGCCAGGCTGG - Intergenic
1004923582 6:20399213-20399235 TTACACCATGTTTGCCAGGCTGG + Intergenic
1005333138 6:24768180-24768202 TTACCCCATGTTGGCCAGGCTGG - Intergenic
1005524058 6:26628121-26628143 TTTCCCCATATTGGCCAGGCTGG - Intergenic
1005647822 6:27858102-27858124 CTACTCCATATTTGCTAGCCTGG + Intronic
1005728369 6:28671581-28671603 TTTCACCATATTGGCAAGGCTGG - Intergenic
1005878809 6:30038106-30038128 ATACACCATGTTGGCCAGGCTGG - Intergenic
1006174728 6:32115094-32115116 ATACCCCAGAGTTGCAGGGGTGG + Intronic
1006191290 6:32211061-32211083 TTTCCCCATGTTTGCCAGGCTGG - Intronic
1006607161 6:35266346-35266368 TTTCACCATATTTGCCAGGCTGG + Intronic
1007018617 6:38496022-38496044 ATACACAACATTTGCAAAGCAGG + Intronic
1007651238 6:43423926-43423948 TTTCCCCATATCGGCAAGGCTGG + Intergenic
1007724412 6:43906389-43906411 ATTCACCATATTGGCCAGGCTGG + Intergenic
1008013797 6:46495196-46495218 TTCCACCATATTGGCAAGGCTGG + Intergenic
1008423004 6:51324506-51324528 TTTCACCATATTGGCAAGGCTGG - Intergenic
1008733906 6:54518825-54518847 TTTCACCATATTGGCAAGGCTGG - Intergenic
1009430474 6:63560140-63560162 TTTCCCCATGTTTGCCAGGCTGG - Intronic
1009498469 6:64380818-64380840 TTTCGCCATATTTGCAAGGCTGG - Intronic
1010355609 6:74929063-74929085 ATACCCAATATTTGCTTGTCAGG - Intergenic
1010986263 6:82427989-82428011 AAAGCCCATGTTTGCAAGGGTGG + Intergenic
1011799765 6:90999083-90999105 TTTCACCATATTGGCAAGGCTGG + Intergenic
1012405367 6:98890721-98890743 TTTCACCATATTTGCCAGGCTGG - Intronic
1012702075 6:102471606-102471628 ATATCCCATGTATGCAAGTCTGG - Intergenic
1012778172 6:103523493-103523515 TTCCCCAATCTTTGCAAGGCAGG + Intergenic
1013000662 6:106019068-106019090 TTTCACCATGTTTGCAAGGCTGG - Intergenic
1014056287 6:117018430-117018452 TTTCCCCATGTTTGCCAGGCTGG - Intergenic
1014134736 6:117875545-117875567 ATCGCCCATAGATGCAAGGCTGG - Intergenic
1016282252 6:142431725-142431747 CTTCACCATATTTGCCAGGCTGG - Intronic
1016289872 6:142517507-142517529 ATTCACCATATTGGCCAGGCTGG + Intergenic
1016749090 6:147613001-147613023 TTTCACCATATTAGCAAGGCTGG - Intronic
1019372889 7:672345-672367 ATTCACCATATTGGCCAGGCTGG + Intronic
1020796032 7:12679710-12679732 TTACACCATATTGGCCAGGCTGG + Intergenic
1021341754 7:19472507-19472529 ATACCCCAGGTATGCACGGCTGG + Intergenic
1021548512 7:21843674-21843696 TTTCACCATATTTGCCAGGCTGG + Intronic
1021971464 7:25969228-25969250 TTACACCATATTGGCCAGGCTGG - Intergenic
1022308784 7:29175369-29175391 TTTCACCATATTGGCAAGGCTGG + Intronic
1022407484 7:30104916-30104938 TTTCACCATATTGGCAAGGCTGG + Intronic
1022733571 7:33055127-33055149 TTTCTCCATATTTGCCAGGCTGG - Intronic
1023157648 7:37266815-37266837 TTTCCCCATGTTGGCAAGGCTGG - Intronic
1023210178 7:37794940-37794962 TTTCACCATATTGGCAAGGCTGG + Intronic
1023232122 7:38044585-38044607 ATACCCAGTAGTTGCATGGCTGG + Intergenic
1023428854 7:40068496-40068518 ATTCACCATGTTGGCAAGGCTGG - Intronic
1023434400 7:40127217-40127239 TTTCACCATATTGGCAAGGCTGG - Exonic
1023544812 7:41307161-41307183 TTTCCCCATGTTGGCAAGGCTGG - Intergenic
1023587215 7:41743207-41743229 ATACCTCATATATGCCATGCAGG + Intergenic
1024115980 7:46193904-46193926 TTATCCCATATATTCAAGGCTGG - Intergenic
1024147028 7:46528019-46528041 ATTCACCATATTGGCCAGGCTGG + Intergenic
1025076218 7:55945493-55945515 TTTCACCATATTGGCAAGGCTGG - Intergenic
1025602448 7:63013268-63013290 TTTCACCATATTGGCAAGGCTGG + Intergenic
1025839884 7:65136402-65136424 TTTCCCCATATTGGCCAGGCTGG + Intergenic
1025883182 7:65559563-65559585 TTTCCCCATATTGGCCAGGCTGG - Intergenic
1025890264 7:65643043-65643065 TTTCCCCATATTGGCCAGGCTGG + Intergenic
1025989248 7:66483174-66483196 ATTCACCATGTTTGCCAGGCTGG - Intergenic
1026021182 7:66707490-66707512 TTTCCCCATATTGGCCAGGCTGG - Intronic
1026072603 7:67135497-67135519 TTTCCCCATATTGGCCAGGCTGG + Intronic
1026079911 7:67208492-67208514 ATTCACCATATTGGCCAGGCTGG - Intronic
1026133504 7:67639737-67639759 ATAACAGATATTGGCAAGGCTGG + Intergenic
1026304978 7:69132853-69132875 TTTCCCCATATTGGCCAGGCTGG + Intergenic
1026554555 7:71394904-71394926 TTTCCCCATATTGGCCAGGCTGG - Intronic
1026704289 7:72676761-72676783 TTTCCCCATATTGGCCAGGCTGG - Intronic
1027397726 7:77773565-77773587 TTTCCCCATATTGGCTAGGCTGG - Intronic
1028759592 7:94480608-94480630 ATCCTCCATATTTGCAAGCCTGG + Intergenic
1029235043 7:99108412-99108434 TTTCACCATATTTGCCAGGCTGG - Intronic
1029687633 7:102159663-102159685 ATTCACCATATTGGCCAGGCTGG - Intronic
1030882970 7:114904097-114904119 TTTCCCCATGTTGGCAAGGCTGG + Intergenic
1030999342 7:116396791-116396813 TTTCCCCATATTGGCCAGGCTGG + Intronic
1031186963 7:118493840-118493862 TTTCCCCATATTGGCCAGGCTGG + Intergenic
1032310593 7:130782617-130782639 TTTCCCCATATTGGCCAGGCTGG + Intergenic
1032335375 7:131019991-131020013 TTTCCCCATATTGGCCAGGCTGG - Intergenic
1032488025 7:132303070-132303092 TTTCACCATATTTGCCAGGCTGG + Intronic
1033126158 7:138709011-138709033 TTTCCCCATGTTTGCTAGGCTGG - Intronic
1033327945 7:140394802-140394824 TTTCACCATATTGGCAAGGCTGG + Intronic
1033796733 7:144854043-144854065 TTTCGCCATATTTGCCAGGCTGG - Intergenic
1033923635 7:146428255-146428277 ATACCCCATATTGGGACTGCTGG + Intronic
1035131817 7:156661514-156661536 ATTCCCCATGTTGGCCAGGCAGG + Intronic
1035886721 8:3299254-3299276 TTTCCCCATATTGGCCAGGCTGG - Intronic
1036029723 8:4955649-4955671 TTTCCCCATATTGGCCAGGCTGG + Intronic
1036391204 8:8325711-8325733 TTTCCCCATATTGGCCAGGCTGG - Intronic
1037929917 8:22872870-22872892 TTTCCCCATATTGGCAAGGCTGG + Intronic
1038025777 8:23588993-23589015 TTATCCCAGATGTGCAAGGCTGG - Intergenic
1038483798 8:27919517-27919539 CTAGCCCATTTTTGCCAGGCTGG - Intronic
1038800269 8:30743349-30743371 TTTCACCATATTTGCCAGGCTGG + Intronic
1039459332 8:37730278-37730300 TTACACCATATTGGCCAGGCTGG - Intergenic
1040420290 8:47233226-47233248 TTATCCCAGGTTTGCAAGGCTGG + Intergenic
1041052381 8:53950033-53950055 TTTCCCCATATTGGCCAGGCTGG + Intronic
1041533182 8:58894990-58895012 TTTCCCCATATTGGCCAGGCTGG - Intronic
1041920515 8:63177951-63177973 TTTCACCATATTGGCAAGGCTGG + Intronic
1042539506 8:69893956-69893978 CTTCCCCATGTTGGCAAGGCTGG - Intergenic
1042579961 8:70265940-70265962 TTACACCATATTGGCCAGGCTGG - Intronic
1042790495 8:72600074-72600096 ATACCCCATAATGGGATGGCTGG - Intronic
1042958828 8:74280812-74280834 ATGCTCCGTAATTGCAAGGCAGG - Intronic
1043419779 8:80086676-80086698 ATTCACCATATTGGCCAGGCTGG - Intronic
1043434273 8:80223151-80223173 TTTCCCCATATTGGCCAGGCTGG - Intronic
1043866103 8:85377607-85377629 TTTCACCATGTTTGCAAGGCTGG - Intronic
1044059035 8:87610939-87610961 TTATCCCATATATGCAATGCTGG - Intronic
1044190670 8:89313115-89313137 ATCCCCCATCTTTTCGAGGCTGG + Intergenic
1045013171 8:97976302-97976324 TTTCGCCATATTGGCAAGGCTGG + Intronic
1045028375 8:98111410-98111432 TTTCCCCATGTTGGCAAGGCTGG - Intronic
1045128986 8:99126896-99126918 TTTCACCATATTTGCATGGCTGG - Intronic
1046638628 8:116700895-116700917 ATACCCTATATTTAGAAGGGTGG - Intronic
1047629740 8:126694084-126694106 TTTCCCCATATTGGCCAGGCTGG + Intergenic
1047960961 8:130011323-130011345 TTTCCCCATATTGGCCAGGCCGG - Intronic
1048620218 8:136124370-136124392 ATACCCCATAATGGGATGGCTGG + Intergenic
1049978222 9:880529-880551 ATTCACCATATTGGCCAGGCTGG - Intronic
1050034708 9:1423289-1423311 TTTCCCCATTTTAGCAAGGCAGG - Intergenic
1050063022 9:1730107-1730129 GAACCCCATATTTGGAAAGCTGG - Intergenic
1050389461 9:5123661-5123683 ATACCCCATAGTGGGAATGCTGG + Intronic
1050397417 9:5214281-5214303 ATTCACCATATTGGCCAGGCTGG + Intergenic
1050551109 9:6749212-6749234 TTTCGCCATATTTGCCAGGCTGG + Intronic
1050803162 9:9640999-9641021 ATACCTCATATTGGCAATGCTGG + Intronic
1050999276 9:12260067-12260089 TTTCACCATATTGGCAAGGCTGG + Intergenic
1051000015 9:12270219-12270241 TTTCACCATATTGGCAAGGCTGG - Intergenic
1051236207 9:15001904-15001926 TTTCCCCATATTGGCCAGGCTGG - Intergenic
1051561433 9:18445473-18445495 ATATCCCATATTTACAAAACAGG + Intergenic
1051625167 9:19092259-19092281 TTACACCATATTTCCCAGGCTGG - Intronic
1052636105 9:31106642-31106664 TTTCACCATATTGGCAAGGCTGG - Intergenic
1053194667 9:36107390-36107412 TTACACCATATTGGCCAGGCTGG - Intronic
1053209359 9:36214619-36214641 ATACCAAATATTTGAAAGGATGG - Exonic
1053438577 9:38094898-38094920 TTTCTCCATATTTGCCAGGCTGG + Intergenic
1053621367 9:39822241-39822263 TTTCACCATATTTGCCAGGCTGG - Intergenic
1053708363 9:40779161-40779183 ATTCACCATATTGGCCAGGCTGG + Intergenic
1053883725 9:42622072-42622094 TTTCACCATATTTGCCAGGCTGG + Intergenic
1053888943 9:42672226-42672248 TTTCACCATATTTGCCAGGCTGG - Intergenic
1054222745 9:62429522-62429544 TTTCACCATATTTGCCAGGCTGG + Intergenic
1054227965 9:62479654-62479676 TTTCACCATATTTGCCAGGCTGG - Intergenic
1054262797 9:62885202-62885224 TTTCACCATATTTGCCAGGCTGG + Intergenic
1054418272 9:64899953-64899975 ATTCACCATATTGGCCAGGCTGG + Intergenic
1054765089 9:69036418-69036440 ACACCTAATATTTTCAAGGCTGG + Intronic
1055628071 9:78194849-78194871 TTTCGCCATATTGGCAAGGCTGG - Intergenic
1055644845 9:78353509-78353531 TTTCACCATATTTGCCAGGCTGG + Intergenic
1055942400 9:81663039-81663061 TTTCACCATATTGGCAAGGCTGG + Intronic
1056131734 9:83593878-83593900 TTTCACCATATTGGCAAGGCTGG + Intergenic
1056528028 9:87461881-87461903 ATTCACCATATTGGCCAGGCTGG - Intergenic
1056587261 9:87937022-87937044 TTTCACCATATTTGCCAGGCTGG - Intergenic
1056609616 9:88115921-88115943 TTTCACCATATTTGCCAGGCTGG + Intergenic
1057074663 9:92131920-92131942 AAACCCCATGTTGGCCAGGCTGG + Intergenic
1057084634 9:92197684-92197706 AAACCCCATGTTGGCCAGGCTGG - Intergenic
1058224110 9:102338806-102338828 CTTCCCCATCTTAGCAAGGCAGG + Intergenic
1058431331 9:104922910-104922932 TTTCACCATATTTGCCAGGCTGG + Intronic
1059313450 9:113404574-113404596 GTTCCCCATATTGGCCAGGCTGG + Intergenic
1059317115 9:113435365-113435387 TTTCCCCATGTTGGCAAGGCTGG + Intergenic
1060638621 9:125220195-125220217 TTACCCCATGTTGGCCAGGCTGG + Intronic
1060854970 9:126907857-126907879 TTTCCCCATATTGGCCAGGCTGG - Intergenic
1061106562 9:128535323-128535345 TTTCCCCATATTGGCCAGGCTGG - Intronic
1061526905 9:131173251-131173273 TTTCACCATATTTGCCAGGCTGG + Intronic
1185541341 X:905198-905220 GTTCCCCATATTGGCCAGGCTGG - Intergenic
1185579207 X:1197616-1197638 TTTCCCCATATTGGCCAGGCTGG - Intronic
1185717537 X:2354655-2354677 TTTCCCCATATTGGCCAGGCTGG + Intronic
1185890769 X:3819912-3819934 AAACTCTGTATTTGCAAGGCGGG + Intronic
1185890917 X:3821341-3821363 AAACTCTGTATTTGCAAGGCGGG + Intronic
1185963158 X:4568475-4568497 ATATCCTATCTATGCAAGGCTGG - Intergenic
1186398761 X:9237152-9237174 ATACCCTATATTTGTTAGGAGGG + Intergenic
1186942958 X:14531253-14531275 ATACCCCTTCTTTGAAAAGCTGG + Intronic
1187446243 X:19363846-19363868 TTACACCATATTGGCCAGGCTGG + Intronic
1187517877 X:19989298-19989320 TTTCACCATATTTGCCAGGCTGG - Intergenic
1188318540 X:28706844-28706866 GTACACCATATTTGCAAATCTGG - Intronic
1188598607 X:31932548-31932570 TTTCACCATATTTGCCAGGCTGG - Intronic
1189389875 X:40567286-40567308 GTTCCCCATATTTGCCAGACTGG - Intergenic
1189880929 X:45491487-45491509 TTTCACCATATTTGCCAGGCTGG + Intergenic
1190520477 X:51274206-51274228 AAACCCCAAATCTGCAGGGCAGG - Intergenic
1190555838 X:51634586-51634608 TTTCACCATGTTTGCAAGGCTGG + Intergenic
1190902236 X:54687356-54687378 TTATCCCACATATGCAAGGCTGG - Intergenic
1191103484 X:56758136-56758158 TTTCACCATATTTGCCAGGCTGG - Intergenic
1191182210 X:57575975-57575997 TTTCACCATATTGGCAAGGCTGG - Intergenic
1192338744 X:70243953-70243975 TTTCACCATATTTGCTAGGCTGG - Intergenic
1192462283 X:71327288-71327310 ATTCCCCATGTTGGCCAGGCTGG - Intergenic
1192595501 X:72403629-72403651 TTTCACCATATTTGCCAGGCTGG - Intronic
1194631106 X:96285246-96285268 TTTCACCATATTGGCAAGGCTGG - Intergenic
1194761610 X:97802459-97802481 CTTCCCCAAATTAGCAAGGCAGG - Intergenic
1194840693 X:98737537-98737559 ATACCCAATAATTTGAAGGCAGG + Intergenic
1195369954 X:104163861-104163883 TTACACCATATTGGCCAGGCTGG + Intergenic
1195659515 X:107364120-107364142 CTTCCCCATATTGGCCAGGCTGG - Intergenic
1196112389 X:111961005-111961027 TTTCACCATATTGGCAAGGCTGG + Intronic
1196822795 X:119715869-119715891 TTTCACCATATTTGCCAGGCTGG + Intergenic
1197139955 X:123106666-123106688 TTTCCCCATATTGGCCAGGCTGG - Intergenic
1197660150 X:129162050-129162072 TTTCACCATGTTTGCAAGGCTGG + Intergenic
1197732604 X:129824211-129824233 ATACCCCATGTTAGCAAGGGTGG + Intronic
1200691556 Y:6309666-6309688 TTTCACCATATTTGCCAGGCTGG + Intergenic
1200693373 Y:6331573-6331595 CTTCCCCATTTTAGCAAGGCAGG + Intergenic
1200895249 Y:8368993-8369015 ATACCCAATAATGGCATGGCTGG - Intergenic
1201010112 Y:9543475-9543497 TTTCACCATATTTGCCAGGCTGG - Intergenic
1201043716 Y:9865058-9865080 TTTCACCATATTTGCCAGGCTGG - Intergenic
1201477543 Y:14399348-14399370 TTACACCATATTAGCCAGGCTGG - Intergenic
1201705253 Y:16929570-16929592 CTTCCCCAAATTAGCAAGGCAGG + Intergenic
1201898962 Y:19026553-19026575 TTTCCCCATATTGGCCAGGCTGG + Intergenic
1201983905 Y:19940483-19940505 TTTCACCATATTGGCAAGGCTGG - Intergenic
1202012232 Y:20355859-20355881 TTTCACCATATTTGCCAGGCTGG - Intergenic
1202114955 Y:21463571-21463593 CTTCACCATATTTGCCAGGCTGG - Intergenic
1202119176 Y:21506915-21506937 TTTCACCATATTTGCCAGGCTGG - Intergenic
1202121628 Y:21530455-21530477 TTTCACCATATTTGCCAGGCTGG - Intronic
1202157377 Y:21898927-21898949 TTTCACCATATTTGCCAGGCTGG + Intronic
1202159824 Y:21922468-21922490 TTTCACCATATTTGCCAGGCTGG + Intergenic
1202186264 Y:22187393-22187415 TTTCACCATATTTGCCAGGCTGG + Intergenic
1202186599 Y:22191448-22191470 TTTCACCATATTTGCCAGGCTGG + Intergenic
1202204760 Y:22394948-22394970 TTTCACCATATTTGCCAGGCTGG - Intronic
1202205095 Y:22399003-22399025 TTTCACCATATTTGCCAGGCTGG - Intronic
1202267110 Y:23031136-23031158 TTTCACCATATTTGCCAGGCTGG - Intergenic
1202348898 Y:23965828-23965850 ATACCCCATAATGGGATGGCTGG - Intergenic
1202420102 Y:24664880-24664902 TTTCACCATATTTGCCAGGCTGG - Intergenic
1202450684 Y:25005203-25005225 TTTCACCATATTTGCCAGGCTGG + Intergenic
1202521877 Y:25704276-25704298 ATACCCCATAATGGGATGGCTGG + Intergenic