ID: 967924028

View in Genome Browser
Species Human (GRCh38)
Location 3:194632816-194632838
Sequence CCCAGGGCTCGCGGTGTCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 5, 3: 15, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967924019_967924028 21 Left 967924019 3:194632772-194632794 CCCAGGTCACACTGCGAGTCAAT 0: 1
1: 1
2: 14
3: 208
4: 1132
Right 967924028 3:194632816-194632838 CCCAGGGCTCGCGGTGTCCTCGG 0: 1
1: 0
2: 5
3: 15
4: 144
967924020_967924028 20 Left 967924020 3:194632773-194632795 CCAGGTCACACTGCGAGTCAATG 0: 1
1: 0
2: 1
3: 27
4: 226
Right 967924028 3:194632816-194632838 CCCAGGGCTCGCGGTGTCCTCGG 0: 1
1: 0
2: 5
3: 15
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967924028 Original CRISPR CCCAGGGCTCGCGGTGTCCT CGG Intronic
900118250 1:1037675-1037697 CACAGGGCTCTCAGGGTCCTAGG + Intronic
900290616 1:1922107-1922129 CCCTGGGCTTGCGGGGTCCAGGG + Exonic
900363096 1:2299365-2299387 ACCCGGGCTCTCGGTGCCCTGGG + Intronic
901927084 1:12573107-12573129 CCAAGGGCTCCCAGTGCCCTAGG + Intronic
905630371 1:39515012-39515034 CTCAGGGCTCGCGCTGTCCCAGG + Intronic
905667388 1:39771177-39771199 CTCAGGGCTCGCGCTGTCCCAGG - Exonic
907403117 1:54238034-54238056 CCCAGGACTTTCTGTGTCCTGGG + Intronic
915525513 1:156473697-156473719 CCCAGTGCGCGGGCTGTCCTGGG - Intronic
915637190 1:157195301-157195323 CCCAGCGCTCAGGGTGACCTGGG - Intergenic
917846892 1:179026637-179026659 CCCGGGGCCCGCGGTCTCCTGGG + Intronic
1062860536 10:806174-806196 CCCATGTCTCACTGTGTCCTTGG - Intergenic
1063367049 10:5497112-5497134 CCCAGGGCTCCCTTTGTCCTGGG - Intergenic
1064295960 10:14079351-14079373 CCCAGACCTCCTGGTGTCCTGGG + Intronic
1066230792 10:33430945-33430967 CCCAGGGCTTGCAGTTTCATCGG - Intergenic
1071457234 10:85860272-85860294 CCCAGGGCTCTGGGTGACCTAGG + Intronic
1071506668 10:86236550-86236572 CCTAGGGCTCAAGCTGTCCTGGG - Intronic
1072754267 10:98008148-98008170 CCCAGGGCTGGTGCTGGCCTGGG - Intronic
1075346251 10:121683920-121683942 CCCAGGGCAGGAGGTGCCCTAGG + Intergenic
1076494952 10:130890950-130890972 CTCAGGGCTGGCTGTGGCCTTGG - Intergenic
1076643256 10:131933422-131933444 TCAAGGGCTCGCAGTGACCTGGG - Intronic
1077225827 11:1438746-1438768 CCCAGGGCTGGGGACGTCCTGGG - Intronic
1077364938 11:2157845-2157867 GCCATGGTTCGCGGTGCCCTCGG - Intronic
1077437645 11:2550496-2550518 CCCAGGGCGGGCAGTGCCCTTGG - Intronic
1078470391 11:11581548-11581570 CCAAGGGCTGGGGGTGTCATGGG - Intronic
1078509606 11:11975672-11975694 CCCAGGGCTAGGGGTATCCTGGG + Intronic
1080406891 11:31987555-31987577 CCCGGGGCTGGCGCTGTCCGCGG - Intronic
1084153546 11:67302174-67302196 CCGGGGGCTGGGGGTGTCCTGGG - Exonic
1084666583 11:70579621-70579643 CCCAGGACCCCCGGTGTCCCCGG + Intronic
1085508566 11:77073872-77073894 CCCAGAGCTCTGGGTGGCCTAGG + Intronic
1085982829 11:81744848-81744870 CCCAGAACTCGCGGTGGCCCAGG + Intergenic
1091243256 11:134069267-134069289 CCGAGGGCTCCCGGGGTCCCGGG + Intronic
1092832857 12:12462180-12462202 CCCAGTGCTCACTGTGTGCTGGG + Intronic
1093153860 12:15656647-15656669 CCCAGGGCTCAAGCAGTCCTTGG + Intronic
1093714449 12:22365963-22365985 CCCAGGGCTCGGGGGGGCGTAGG - Intronic
1094836504 12:34324614-34324636 CCCGGGGATCCTGGTGTCCTTGG - Intergenic
1096879806 12:54658462-54658484 CCCAGGTCTCCCAGTGCCCTTGG + Intergenic
1103309033 12:119989725-119989747 CCCAGGGCTCGCGGGGACCCGGG + Intergenic
1104000460 12:124856816-124856838 CCCAGGGCTCCCAGTGACCCCGG - Intronic
1104448775 12:128853377-128853399 CCCAGGGCTCGCGCCGCCCGAGG + Intergenic
1104748377 12:131223653-131223675 ACCAGGGCTGGCGGTGGCCGAGG - Intergenic
1105024466 12:132839054-132839076 CTCTGGGCTCCAGGTGTCCTAGG - Intronic
1105492640 13:20903057-20903079 CCCCGGCCTCGCGGTGCCCCCGG + Intergenic
1105699797 13:22927129-22927151 GCCTGGGCTCGGGGTGGCCTTGG - Intergenic
1107548833 13:41457290-41457312 CCCGGCCCACGCGGTGTCCTCGG - Intergenic
1113826248 13:113256294-113256316 ACCAGGGCTGGCAGTGCCCTCGG + Intronic
1113851412 13:113420832-113420854 CCCAGGGGTAGAGGTGTCCCAGG - Intergenic
1113851439 13:113420899-113420921 CCCAGGGGTAGTGGTGTCCCGGG - Intergenic
1113851543 13:113421168-113421190 CCCAGGGGTAGGCGTGTCCTGGG - Intergenic
1113851565 13:113421219-113421241 CCCGGGGGTAGAGGTGTCCTGGG - Intergenic
1113851620 13:113421353-113421375 CCCAGGGGTAGAGGTGTCCCGGG - Intergenic
1113851667 13:113421473-113421495 CCCAGGGGTAGAGGTGTCCTGGG - Intergenic
1115516281 14:34188234-34188256 ACCAGGACTTGCGGTGCCCTAGG - Intronic
1118664261 14:68049606-68049628 CCCAGGGCTCCTGGTCTCCTTGG + Intronic
1120707172 14:87756991-87757013 CCCAGGGGTCCCAGTGGCCTGGG + Intergenic
1122556673 14:102584267-102584289 CCCAGTACTTGCAGTGTCCTGGG + Intergenic
1122906476 14:104803958-104803980 CCCTGGGCTCCTGGTGTGCTGGG + Exonic
1129332377 15:74834250-74834272 CCCAGGGCTGGCTCTGTGCTTGG + Intergenic
1131017769 15:89071993-89072015 CCCAGGACTGGGGGTTTCCTGGG - Intergenic
1132549283 16:547662-547684 CCCAGGGCTCGGGCTGGGCTGGG + Exonic
1132883227 16:2171409-2171431 CCCAGGGCTCTCGGGGGCCGGGG + Intronic
1133055550 16:3143941-3143963 CCCTGGGCTCTCAGTGCCCTGGG - Intergenic
1133768138 16:8851900-8851922 CCCGGGGCTGGCAGAGTCCTAGG - Intergenic
1134529792 16:14974666-14974688 CGCAGGACTCGCAGCGTCCTCGG - Intronic
1136552461 16:30989066-30989088 CCCAGGGCTGGCGATGTGCTGGG - Exonic
1137547824 16:49416427-49416449 CCCTGGCCTTGAGGTGTCCTGGG - Intergenic
1138659438 16:58508781-58508803 CCCAGGGCTCCCCATGTTCTTGG - Intronic
1139866556 16:70066296-70066318 CGCAGGACTCGCAGCGTCCTCGG + Intergenic
1142100574 16:88268915-88268937 CCCAGGGCTCTATGTGTCCAAGG - Intergenic
1142421369 16:89972552-89972574 CCCTGCGCTCGCGGGGCCCTAGG + Intergenic
1142694852 17:1628080-1628102 CCGCGGGCTCGGGGTGTCCCAGG - Exonic
1148789686 17:50166288-50166310 CTGAGGGCTGGAGGTGTCCTAGG + Intronic
1149640120 17:58197285-58197307 CCCAGGGATGGCTGTTTCCTGGG - Intronic
1150294100 17:63998691-63998713 CCCAGGGCTGGGGGTGTGCGCGG - Exonic
1152352061 17:79789771-79789793 CCCATCGCTCCCGGTGCCCTCGG - Intergenic
1152706510 17:81846349-81846371 CTCTGGGCTCTCAGTGTCCTGGG - Intronic
1161419988 19:4171438-4171460 CCCAGGGCTCTCGGTTTTGTTGG - Exonic
1161454312 19:4362536-4362558 CCAAGGGCTGGCCCTGTCCTGGG - Intronic
1161591190 19:5129805-5129827 CCCAGGGCTCACGGTGTTCTGGG + Intronic
1162176165 19:8832138-8832160 CCCGTGGCTGGCGGTGTCCGCGG + Intronic
1162532527 19:11244017-11244039 CCCATGGCTCCCGCTGTCCTTGG + Intronic
1166406899 19:42527932-42527954 CCCAGGGCTCTTCATGTCCTGGG + Intronic
1167757610 19:51422147-51422169 CCCAGAGCCCGCGCTGTCCATGG + Intergenic
1167772172 19:51528220-51528242 GGCAGGGCTGGTGGTGTCCTGGG - Exonic
1167782485 19:51608146-51608168 CCCAGGGTTGGCGCTGTCCATGG + Intergenic
925120496 2:1415017-1415039 CCCGGGGCCAGCGGTGTCCATGG - Intronic
925420077 2:3704199-3704221 CCCAGGCCACGTGGTTTCCTGGG + Intronic
927213101 2:20650785-20650807 CCCAGGGCTCCCGCTGTCCTTGG + Intronic
927226065 2:20767256-20767278 CCCAGGCCTCTCTGTGCCCTTGG + Intronic
932657708 2:73624761-73624783 CCCAGGGATCCCGGTGACGTCGG + Intergenic
932664384 2:73685045-73685067 CCCAGGGATCCCGGTGACGTCGG + Intergenic
932714539 2:74091758-74091780 GCCTGTGCTCGTGGTGTCCTAGG + Intronic
932731854 2:74227169-74227191 CCGAGGGCCCGCTGGGTCCTGGG + Intronic
938134058 2:128739336-128739358 ACCAGGTCTGGGGGTGTCCTGGG - Intergenic
941615077 2:167709464-167709486 CCCAGGGCTCAAGATGTCATTGG + Intergenic
946351796 2:219160299-219160321 CCTAGGGTTCGCGCTGTCCCAGG - Intronic
948588940 2:239037382-239037404 TCCAGGGCTGGCGGATTCCTAGG + Intergenic
1169897745 20:10522525-10522547 CACATGGCTCCCGGTCTCCTGGG + Intronic
1170582550 20:17710208-17710230 CCCAGGGCTCATGGTTTCCATGG - Intronic
1172221072 20:33275624-33275646 CCTGGGGCTCACAGTGTCCTGGG - Intronic
1172486821 20:35303559-35303581 CCCAGGGCCTGCTGTGGCCTAGG - Exonic
1174066856 20:47871884-47871906 CCCAGAGCTGCCGGTGTCATGGG - Intergenic
1174400821 20:50274978-50275000 CCCAGAGCTCCCAGTGACCTTGG + Intergenic
1175532590 20:59684403-59684425 CCCAGGCCTGGAGGTGGCCTTGG + Intronic
1175793089 20:61754502-61754524 CACAGGGCTTGGGGTGTCCCTGG + Intronic
1175890820 20:62315137-62315159 CACACGGGTGGCGGTGTCCTGGG + Exonic
1176260459 20:64176804-64176826 CCCAGGGCAGGCAGTGTGCTGGG - Intronic
1180092542 21:45540399-45540421 CCCAGGGCTCCCGGGCCCCTGGG - Intronic
1180143736 21:45908551-45908573 TCCAGAGCTGGGGGTGTCCTGGG + Intronic
1180186067 21:46139883-46139905 CCCAGGCCTTGCGGTGTCCATGG + Intronic
1180238794 21:46484074-46484096 CCCAGGCCAAGGGGTGTCCTTGG - Intronic
1182558358 22:31140998-31141020 CCCAGGGCTCCCCGCTTCCTAGG + Intergenic
1182691918 22:32170284-32170306 CTCAGGGCTGGTGGTGCCCTGGG + Intergenic
1182713173 22:32335143-32335165 CCCAGGGCTCCCAGTGTCCTTGG - Intergenic
1183084833 22:35480361-35480383 CCAAGGGCTCTCGGTGTTCCAGG + Intergenic
1183362505 22:37389990-37390012 CCCAGGGCCCGTGGGCTCCTTGG - Intronic
952335754 3:32401776-32401798 GGCAGGGCTCGCGGCGTCCGCGG + Intronic
952901508 3:38114700-38114722 CCCAGGGCTGGTGCTGACCTCGG - Intronic
960086277 3:113594916-113594938 CCCAGGGCTGGCAGTGACATGGG + Intronic
967924028 3:194632816-194632838 CCCAGGGCTCGCGGTGTCCTCGG + Intronic
968489419 4:882087-882109 ACAAGGGCTCGCGGGGTCCTCGG + Intronic
968502145 4:955750-955772 CCGAGGGCTCCCTGTGGCCTGGG - Exonic
968725728 4:2247045-2247067 CCCAGGGAGCGGGCTGTCCTCGG + Intergenic
968756468 4:2418669-2418691 CCCGGGGCTCGCGGCGCCCTAGG - Intergenic
968908808 4:3466384-3466406 CCCACGGCTAGTGCTGTCCTGGG + Intronic
969691383 4:8705951-8705973 CCCAGGGCACACGGAGTCCTTGG - Intergenic
984735984 4:183108529-183108551 CCCAGGGGTGGAGGAGTCCTGGG + Intronic
985128950 4:186723336-186723358 CGCCGGCCTCGCGGTCTCCTGGG - Intronic
985644855 5:1080070-1080092 CCCATTGCTCGGGGTGGCCTGGG + Intronic
986329547 5:6707417-6707439 CCCAGGGCTCTCAGTGGCCAGGG - Intergenic
986348805 5:6858448-6858470 CCCTGGCCTCCCAGTGTCCTGGG + Intergenic
987340509 5:16935710-16935732 CCCAGGGCGCGCGGCGTGGTGGG + Intronic
1001724448 5:173885304-173885326 CCCTGGGCTCTGGGTATCCTGGG + Intergenic
1002577073 5:180180048-180180070 CCCAGGGCTTGGGGTGGCCCTGG - Intronic
1008382435 6:50850019-50850041 CGCCGGGATCGCGGTATCCTAGG + Intergenic
1008598974 6:53070691-53070713 CCCAGGGATTTTGGTGTCCTGGG + Intronic
1018050710 6:160005856-160005878 CCCAGGATGCGCGGGGTCCTGGG - Intronic
1019324732 7:432511-432533 CCCAGGGCCCGGGGAGTTCTTGG + Intergenic
1019524099 7:1472986-1473008 CCCAGGGCTGGCTGTGCGCTGGG + Intronic
1022110215 7:27225553-27225575 CCCAGGGCGCGCGGCTTCCCGGG - Intergenic
1025085442 7:56019717-56019739 CCCATGGCTCGCCGTGTCCTAGG + Exonic
1026271999 7:68844815-68844837 CCCAGGGCTTTCTGTATCCTGGG + Intergenic
1027266322 7:76496995-76497017 CCCGGGGCACGGGGTCTCCTGGG - Intronic
1027317702 7:76995113-76995135 CCCGGGGCACGGGGTCTCCTGGG - Intergenic
1028640665 7:93039361-93039383 CCCAGGCATCCCTGTGTCCTTGG + Intergenic
1029871290 7:103695707-103695729 CCCAGGCCCCGAGGTCTCCTGGG + Intronic
1033767961 7:144515323-144515345 CCCAGGGCTCTTAGAGTCCTGGG + Intronic
1035205243 7:157290416-157290438 TGCAGGGATCGCCGTGTCCTAGG - Intergenic
1036379733 8:8228728-8228750 CGCGGGGCTCGCGGAGTCCAGGG + Intergenic
1040637422 8:49291155-49291177 CCCAGGGCTTGCGGTGTCATAGG - Intergenic
1049222559 8:141434652-141434674 CTCAGGGCTCCCTGTCTCCTGGG + Intergenic
1049403214 8:142440104-142440126 CCCAGGGCTCACGAGGTCTTGGG + Intergenic
1049773803 8:144395612-144395634 CCCAGGGCTCTTGGCGGCCTGGG - Intronic
1053002732 9:34586182-34586204 CCCAGGGCTGGCTGCATCCTAGG + Intronic
1056195535 9:84225000-84225022 CTCAGGGCTAGCGATGTGCTTGG + Intergenic
1056911626 9:90706341-90706363 CCCTGGGATCGCCCTGTCCTTGG - Intergenic
1058153319 9:101486100-101486122 CACTGCGCTCGCGGTGTCTTGGG - Intronic
1059327170 9:113511135-113511157 CCCAGGGCTGCTGGTGCCCTTGG + Intronic
1060033858 9:120238187-120238209 CCCAGAGAGCGTGGTGTCCTGGG - Intergenic
1061176107 9:128998332-128998354 CACAGGGCTCACGTTGGCCTGGG + Intronic
1061904917 9:133691853-133691875 CCCAGGGCTCTGCGGGTCCTGGG - Intronic
1062396968 9:136356487-136356509 CCTGGGGCTCGCCGTGGCCTCGG - Exonic
1190929553 X:54935777-54935799 CCAGGGGCTTGCAGTGTCCTGGG + Intronic
1191249617 X:58254187-58254209 CCCGGGGATCGTGGTGTCCCTGG - Intergenic
1195341769 X:103913595-103913617 CCAAGGCCCCGCTGTGTCCTGGG + Intergenic
1195943313 X:110182762-110182784 CCCATGGCTCAGGGTGCCCTAGG - Intergenic