ID: 967924317

View in Genome Browser
Species Human (GRCh38)
Location 3:194633920-194633942
Sequence GCTCTTGGCTGCGGGGCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967924317_967924324 -4 Left 967924317 3:194633920-194633942 CCCACGGCCCCGCAGCCAAGAGC No data
Right 967924324 3:194633939-194633961 GAGCTGGTTATCTCTGCAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967924317 Original CRISPR GCTCTTGGCTGCGGGGCCGT GGG (reversed) Intergenic